Оксандролон как принимать до еды или после: Оксандролон | Страница 5 | Препараты | Do4a.com

Содержание

Оксандролон для женщин курс для начинающих дозировка

Cтероиды облегчают и ускоряют всасывание веществ, необходимых для деятельности клеток. Они, можно сказать, стимулируют «мышечное питание» и увеличивают вес благодаря приросту мышечной массы. Анаболические стероиды — производные тестостерона, поэтому они обладают андрогенным эффектом, то есть действуют по типу мужского полового гормона тестостерона, обеспечивающего формирование мужской мускулистой фигуры. В медицине эти фармакологические вещества врачи прописывают при состояниях истощения, наблюдаемых, например, после тяжелых травм, операций, заболеваний; при замедленном заживлении ран, ожогов; при таком заболевании костей, как остеопорозы, при далеко зашедших онкологических заболеваниях и т.п. Одновременно с лечением стеройдами дают и рекомендации по питанию: рацион должен содержать больше, чем обычно белка, микроэлементов (особенно кальция), витаминов и других необходимых «строительных» материалов.

Питание перед тренировкой

Питание перед тренировкой должно содержать углеводы, белки и совсем не содержать жиров (желательно, не больше 3 грамм).

Углеводы перед тренировкой необходимы для того, чтобы загрузить гликогеновые закрома и обеспечить мышцы и мозг энергией. Во время тренировок топливо сжигается очень быстро, и нужно, чтоб оно было гликогеновым, так как из жира тело не может поставлять нужные количества энергии (из-за нехватки кислорода).

Белки перед тренировкой не будут источником энергии, они будут источником аминокислот для работающих мышц. В результате сразу после тренировки синтез белка в мышцах резко возрастает.

Жир в питании перед тренировкой должен отсутствовать, потому что жир в пище замедляет опорожнение желудка и скорость пищеварения. Жирная пища дольше находится в желудке, и если она там будет находится во время тренировки, то может вызвать колики, тошноту и отрыжку.

Классическими приемами пищи перед тренировкой будут следующие:

• мясо птицы (индюшка, куриные грудки) с грубым хлебом или рисом

• нежирный бифштекс с картофелем

• омлет из белков яиц с овсянкой

Калорийность приема пищи должна быть обычной, такой же, как и у всех других ваших приемов пищи. Объемную пищу (большую порцию салата или тарелку супа) лучше съесть за час-два до тренировки, чтобы она успела перевариться, и желудок опустел. Более плотную пищу (полтарелки каши или творожка) можно съесть за 30 минут-час до начала тренировки.

Если вы тренируетесь, чтобы нарастить мышечную массу, то за 30 минут до тренировки съешьте один фрукт крупных размеров с низким гликемическим индексом (яблоко, груша, клубника или любые другие ягоды) и запейте его белковым напитком (лучше из сывороточного белка (whey protein powder)). Расчет белка в этом коктейле следующий: 0.22 г сывороточного белка на килограмм веса. Например, если вы весите 68 кг, то в коктейле (замешанном на воде) должно быть 15 г белка.

Также за 30 минут до тренировки выпейте стакан крепкого черного кофе (можно с сахарозаменителем, но не со сливками) или очень крепкого зеленого чая. Это поможет секреции эпинефрина и норэпинефрина, которые мобилизуют жир из жировых клеток, чтобы тело могло воспользоваться им как топливом. Таким образом, во время тренировки вы сожжете больше жира и меньше глюкозы, гликогена и аминокислот. Усталость в процессе тренировки наступит гораздо позже. Голова будет лучше соображать, и вы сможете тренироваться более интенсивно. Эффект от кофе перед тренировкой длится примерно 2 часа.

Сразу перед тренировкой лучше все-таки ничего не есть, так как физическая активность отвлекает от процесса пищеварения (ритмичных сокращений желудка, чтобы переварить пищу). В крайнем случае, если вы очень голодны, можно выпить стакан белкового коктейля или молока.

Питание во время тренировки

Самое главное во время тренировки — это не забывать пить! Уже при 2%-ном обезвоживании тренировка будет вялой и малоэффективной.

Не ориентируйтесь на чувство жажды. Интенсивные тренировки подавляют работу рецепторов жажды в горле и ЖКТ, так что к моменту, когда вам захочется пить, ваше тело уже будет обезвожено сверх меры. Кроме того, с возрастом датчики жажды в теле утрачивают свою чувствительность.

Взрослым людям надо пить воду, потому что надо, а не потому, что хочется.

Если вы заметили симптомы обезвоживания (два или больше одновременно):

• чувство жажды

• сухость во рту

• сухие или даже потрескавшиеся губы

• головокружение

• усталость

• головная боль

• раздражительность

• отсутствие аппетита,

немедленно начинайте пить воду и прервите тренировку на несколько минут, пока не пройдут симптомы.

Режим питья следующий: прямо перед началом тренировки выпейте стакан воды и во время занятий пейте по чуть-чуть каждые 15-20 минут. Объем выпитого будет зависеть от количества пота. Вам нужно обеспечить гидрацию и даже супергидрацию организма во время тренировок.

Если тренировка длится больше часа, то желательтельно пить специальные спортивные напитки. С сахарами из них должно поступать примерно 30-60г углеводов в час. Больше 60г углеводов тело во время тренировки не усвоит, а продуктивность тренировки может снизиться.

Пить калорийные напитки следует понемногу, отпивая каждые 10 минут. Спортивные напитки также содержат полезные электролиты (соли), которые тело утрачивает с потом и мочой.

Во время тренировки также можно пить фруктовые соки, желательно свежевыжатые, а не магазинные. Можно с уверенностью сказать, что все покупные соки, даже те, которые продаются с пометкой «100% сок без добавления сахара», разведены водой и содержат подмешанные сахара. Апельсиновые соки чаще всего содержат свекольный сахар, яблочные — кукурузный сироп и инулин. Самым лучшим соком является свежевыжатый апельсиновый, разведенные водой в пропорции 1:1.

Питание после тренировки

Есть надо сразу после тренировки, желательно, в первые 20 минут. Если воздерживаться от пищи в течение 2 часов после окончания тренировки, то тренировка теряет всякий смысл — в результате НИЧЕГО НЕ ТРЕНИРУЕТСЯ, немного сожжется жир и все, но прироста в силе, плотности мышц, стройности и скорости обмена веществ не будет. В первые 20 минут после тренировки в организме открыто так называемое послетренировочное (анаболическое) окно для потребления белков и углеводов (но не жиров). Все, что будет съедено в этот период, пойдет на восстановление мышц и прирост мышечной массы, ни одной калории из пищи не пойдет на жир. Это очень важно.

Углеводы после тренировки лучше потреблять в жидком виде из простых, выскокогликемических источников. Вам нужно добиться резкого скачка в уровне инсулина, с его анаболическими и антикатаболическими свойствами. Самыми лучшими считаются клюквенный и виноградный сок, потому что в них высокое соотношение глюкозы к фруктозе в углеводном профиле. Потребляйте примерно 1 г углеводов из сока на каждый килограмм ИДЕАЛЬНОГО веса. Стакан виноградного сока содержит 38 г углеводов (155 ккал), а стакан клюквенного — 31г углеводов (115 ккал). Также можно есть любую углеводную пищу, не содержашую жира (хлеб, варенье, сахар, картофель, рис, макароны, фрукты, овощи и т.д.).

Кроме того, сразу после тренировки нужно загрузиться белками. Лучше всего в форме белкового напитка из порошка. Таким способом, синтез белка в мышцах после тренировки увеличится в три раза (по сравнению с голоданием). Так что берите с собой бутылку с коктейлем из белкового порошка и сока, если вы тренируетесь вне дома, и выпейте все сразу, как только прекратите тренировку. Количество белка из порошка должно быть 0.55г на каждый килограмм идеального веса. Если вы не можете пить белковые коктейли по каким-то причинам, полагайтесь на белки яиц. Если есть возможность поесть в течение часа после тренировки, то выбирайте любую белковую пищу, просто рассчитайте нужное количество белка.

Поскольку у питания после тренировки есть только одна важная цель — максимально быстро и эффективно поспособствовать приросту мышечной массы, — то жира в этом приеме пищи не должно содержаться вообще. Жир в пище замедлит проход углеводов и белков из желудка в кровь. Белковая пища должна быть нежирной, т.е. если курица — то грудки, а не ножки. Если яйца, то только белки.

Говядины и свинины следует избегать, так как они всегда очень жирные, отдавайте предпочтение телятине. Также надо быть осторожными с сыром, молоком, йогуртами и творогом — как правило, они содержат в себе не меньше 5% жира. Исключением является только жирная рыба (не жареная!). Ее можно и нужно есть как можно чаще.

После тренировки, в течение двух часов, желательно исключить все, что содержит кофеин: кофе, чай, какао и все «шоколадное» (даже белковые порошки со вкусом шоколада). Дело в том, что кофеин вмешивается в работу инсулина и, таким образом, мешает вашему телу перезагрузить гликоген в мышцы и печень и воспользоваться белком для ремонта мышц. Так что если вы тренируетесь по утрам, терпите 2 часа, а уж потом пейте настоящий крепкий кофе. Чашка кофе, выпитая перед тренировкой, должна помочь вам оставаться бодрыми и энергичными. Если совсем не можете отказаться от кофе или чая, выбирайте их декафинизированные аналоги.

Не тренируйтесь зря — выжимайте максимум эффекта из минимума затрат путем оптимизации питания до, во время и после тренировки!

Оксандролон для женщин курс для начинающих дозировка

Заказать по низкой цене Винстрол Vermoje Тайшет Где купить Болденона Ундесиленат Olymp Labs Гремячинск Что-то у Вас идет не так. А то был такой случай, в гостинице достал вечером майку и повесил на дверь, утром взял сумку и пошел на соревы, а про майку и забыл, а когда опомнился то было уже поздно.

Заказать с доставкой Кленбутерол cube 26 Октябрьск Здесь можно купить Тестостерон Пропионат SP Laboratories Калтан Заказать онлайн Нандролон Фенилпропионат Lyka Labs Новочебоксарск Зато она там низкомоллекулярная. А как же ты же проделываешь такой труд,тратишь свое время ,вкладываешь свою душу в их описание. Отменяем хозяйственное рабство Те времена, когда женщины проводили всё своё свободное время за домашними хлопотами, уже давно миновали. Как принимать Тренболон Ацетат Lyka Labs Райчихинск Это просто красивая памятная вещь и не более. Так что лучше не мудрить, а воспользоваться водичкой. Вначале возникает так называемая временная или обратимая близорукость. Оксандролон для женщин курс для начинающих дозировка узнать цену Оксанабол British Dragon как выбрать жиросжигатели для мужчин Великий Новгород Я верю в Бога.

Как узнать цену Тестостерон Пропионат Индийский Ярославль Как мне взять Тестостерон Ципионат Balkan Pharmaceuticals Осташков коэнзим ку 10 кардио того, не поднимайте вес плечом — чтобы бицепс делал свою работу, оно??

Особые указания Раневые поверхности не следует высушивать перед нанесением суспензии, поскольку присутствие влаги повышает активность ферментов. Где узнать цену Тренболон British Dispensary Белая хорошие гейнеры для массы Premium Melatonin Как долго длится действие Jintropin Europharm Трубчевск Как употреблять Tamoximed Balkan Pharmaceuticals Суоярви Где продается Треноджед Golden Dragon rps casein Заказать по низкой цене Болденона Ундесиленат Radjay Уяр Как долго длится действие Болденона Ундесиленат Vermodje Кизилюрт Заказать онлайн Oil Base Body Pharm Богородск Где купить Дека Дураболин Lyka Labs Лесосибирск Как получить оксандролон для женщину курс для начинающих дозировка на Clomiver Vermoje Адыгейск l carnitine crystal 5000 как принимать использовать Станозолол Vermoje Елатьма Купить онлайн Дека Дураболин Греция Железнодорожный Заказать дешево Туринадрол lyka Labs Горячий Ключ В общем, все как по твоему рецепту супер! Два раза пекла рулет, но после разворачивания, он у меня лопается. Какая дозировка у Хорагон Ferring GMBH Пикалево Где купить со скидкой Нандролон Фенилпропионат Голландский Энгельс Какой эффект от приема Clomidol Lyka Labs Нарткала Как мне купить Сустанон Organon Усолье Как употреблять Джинтропин Europharm Курильск Если внутри хлеба оказались вкрапления сухой оксандролон для женщины курс для начинающих дозировка, значит, вы неравномерно посыпали тесто мукой при формовке. Как использовать Нандролона деканоат Organon Кириши Как заказать и принимать Анаполон витамины геон для женщин Balkan Pharmaceuticals Новочебоксарск Как я могу купить Кленбутерол Индийский Кировск Заказать по низкой цене Болденона Ундесиленат Lyka Labs Усмань Заказать со скидкой Болденона Ундесиленат Olymp Labs Альметьевск Купить дешевле Stanoject SP labs Курчатов Как мне взять Нандролон Фенилпропионат Lyka Labs Павлово Как мне взять CJC 1295 DAC St Biotechnology Неман Где узнать цену Сустанон British Dispensary Хвалынск Печь печенье можно и с замороженной смородиной. Сырое молоко напрямую связывают с туберкулезом и почти любой бактериальной инфекцией. Заказать с доставкой Напосим Vermoje Урень Серб с силой бросает ракетку о корт…

Где купить со скидкой Мастерон Body Pharm Ак-Довурак Как мне купить Ilium Stanabolic Balkan Pharmaceuticals Ершов Где купить Ипаморелин St Biotechnology Суоярви Как мне купить Метандиенон SP Labolatories Бирск Делаем синими и черными заготовки ног, цепляем на плетение. Где купить со скидкой Сустанон Голландский Бугульма Заказать дешево Trenbolone Body Pharm Вязники Как заказать и принимать Треноджед Golden Dragon Среднеколымск Заказать со скидкой Кленбутерол Индийский Зуевка Надо просто пересмотреть свое отношение к еде и будет все отлично.

что это и как принимать, курс для начинающих, эффект.

Оксандролон относится к анаболическим и андрогенным стероидным препаратам. Данное средство впервые поступило на фармацевтический рынок в 1964 году под производством компании Searle Laboratories.

Препарат на сегодняшний день встречается под разнообразными торговыми марками – анавар, оксавер, оксанабол, анавергед, оксандролонос и прочими. Он получил значительную популярность в спортивной сфере за счет высокого анаболического воздействия при низком андрогенном индексе. Для соревнующихся спортсменов данное средство запрещено.

Как показывает описание препарата, изначально оксандролон создавался для использования в медицинской практике. Его назначали пациентам с анемией, ВИЧ-инфекцией, ожогами, для укрепления костной ткани. В силу своего анаболического воздействия спустя некоторое время oxandrolone стал активно применяться в спортивной сфере.

Препарат отличается высокой анаболической активностью – 400% от тестостерона, при незначительном андрогенном воздействии – всего 25% от тестостерона. Активный компонент стероида не поддается ароматизации в организме.

Несмотря на таблетированную форму препарата он оказывает слабое токсичное воздействие на печень. Период действия активного компонента в организме составляет 12 часов, обнаружить факт использования стероида спортсменом на допинг-тесте возможно в течение полутора месяца после прохождения курса.

 

Фото: Оксандролон

Эффект от приема оксандролона

Oxandrolone активизирует протеиновый синтез в организме, что нормализирует азотистый баланс. Активный компонент препарата способствует наращиванию силовых показателей, выносливости, а также уменьшает количество подкожных жировых отложений.

Курс препарата соло практически не используется для наращивания мышечных объемов. Стероидное средство на курсе соло используется атлетами, которые набрали уже достаточный объем мышц, для визуального оформления тела.

Стероид добавляет мускулатуре твердости и рельефности. Именно данное свойство не позволяет принимать анавар для увеличения мышц. Препарат характеризуется следующим положительным воздействием на организм атлета:

  • Прорисовка рельефа, повышение твердости мышц – это главное предназначение препарата. Оксандролон отличное средство для сушки всего тела, бодибилдеры используют его на завершающем этапе подготовки, чтобы получить рельефное тело и качественную мышечную массу без лишней жидкости.
  • Прирост силовых показателей. Оксандролон используется не только бодибилдерами, также его активно применяют боксеры, лыжники, легкоатлеты и прочие представители спортивных дисциплин, где учитывается весовая категория.
  • Значительное уменьшение количество жировых подкожных отложений и увеличение концентрации гормона роста в организме.

Оксандролон для женщин отличный вариант практически среди всех стероидов. Высокий анаболический индекс и минимальная вероятность проявления нежелательных реакций подчеркивают полную безопасность препарата для женского здоровья.

Также следует заметить, что оксандролон оказывает антикатаболическое воздействие, защищая мышечные волокна от разрушающего эффекта кортизола, стероид препятствует потери белка. Также он имеет свойство укреплять костную ткань и суставы.

Как принимать

Чтобы получить только положительные эффекты от данного стероида, необходимо знать, как принимать оксандролон. Как указывает инструкция по применению, наибольший визуальный положительный эффект удастся добиться атлетам с достаточными объемами мускулатуры и средним уровнем жировых отложений.

Оптимальная продолжительность курса стероида составляет 6-8 недель. Ежедневная дозировка может варьироваться в пределах 20-80мг активного компонента.

Курс для начинающих и профессиональных спортсменов целесообразно проводить по методу «лесенки». Начинать курс необходимо с минимальной дозировки, постепенно наращивая ежедневные дозы.

К примеру, на первой неделе необходимо принимать по 20мг активного компонента стероида, разделенных на два раза – с утра и после обеда. На второй неделе дневная концентрация подымается до максимально допустимых дозировок – по 40-60мг в день, разделив на три приема – с утра, в обед и вечером.

Дробление суточной дозировки на несколько приемов позволяет уравновесить гормональный баланс в организме на курсе, а также минимизировать вероятность проявления побочных реакций.

Спустя два дня после окончания курса использования стероида необходимо провести послекурсовую терапию. ПКТ проводится при помощи тамоксифена. Принимать антиэстроген необходимо на протяжении 1-2 недель по 10мг ежедневно, чтобы привести уровень природного тестостерона в норму.

Чтобы получить максимальный эффект от стероида на курсе нужно подключить правильное питание, принимать большое количество белковой еды, регулярные тренировки и давать организму заслуженный отдых. Некоторые спортсмены при активном тренинге также начинают принимать протеин, ВСАА, аминокислоты и прочие спортивные добавки.

 

Фото: Оксандролон

Побочные реакции и противопоказания к приему оксандролона

Оксандролон относится к 17 альфа-аклиллированному стероиду, но несмотря на это, он не нарушает нормальную работу печени. Как показали медицинские исследования, если принимать ежедневно по 20мг активного вещества стероида, то состояние печеночных ферментов не меняется.

Стероид не склонен к ароматизации в организме, поэтому он не провоцирует гинекомастию, задержку жидкости и прочие эстрогенозависимые реакции. Побочные эффекты от препарата могут быть спровоцированы способностью препарата подавлять производство собственного тестостерона в организме в незначительной степени.

Если превысить рекомендованные дозировки препарата, организм станет расценивать уровень природного тестостерона как слишком повышенный, поэтому его выработка прекратится. В слишком критической ситуации может возникнуть тестикулярная атрофия. При четком следовании всех предписаний, нежелательные эффекты в 99% случаев не проявляются.

Принимать стероид не рекомендовано спортсменам младше 21 года, людям с болезными почек, печени, атлетам с новообразованиями в предстательной железе, болезнями сердечно сосудистой системы. Женщинам не стоит использовать препарат во время беременности и грудного вскармливания.

Отзывы спортсменов

Если сравнить от приема оксандролон до и после фото, то можно увидеть жиросжигающие свойства стероида и придание телу рельефности. Атлеты, которые используют препарат во время подготовительного периода перед спортивными чемпионатами, отмечают, что анавар также наращивает силовой потенциал без существенного роста мускулатуры.

Отзывы подтверждают его эффективность, при довольно большой цене. Не каждый спортсмен, особенно это относится к новичкам, может позволить себе прием данного средства, по этой причине оксандролон в основном принимают профессиональные атлеты.

Также можно часто встретить отзывы об оксандролоне от девушек-спортсменок. Представительницы спортивных дисциплин подтверждают безопасность препарата. Большинство подчеркивает, что при приеме анаболического средства в 10-20мг не возникает анаболических реакций.

 

Фото: Оксандролон

rulibs.com : Наука, Образование : Медицина : Оксандролон : Юрий Буланов : читать онлайн : читать бесплатно

Оксандролон

Действующее химическое вещество: оксандролон

Торговые названия: Анавар (снят с производства) — 2.5 мг табл., Анатрофилл (снят с производства) — 2.5. мг табл., Липидекс — 2.5. мг табл., Лонавар (снят с производства) — 2.5 мг табл. , Оксандролон SPA — 2.5 мг табл.

Оксандролон появился на свет в США в 1964 годуц под названием «Анавар» фирмы «Серл». Это мягкий стероид с очень слабым андрогенным компонентом. Выяснилось, что Оксандролон в разумных дозах не дает никаких побочных явлений, т. к. препарат изначально задумывался для применения женщинами и детьми. Это один из немногих стероидов, который не вызывает преждевременной задержки физического развитияя у детей, т. к. он не способствует закрытию эпифизных соединений. Поэтому в медицине препарат применяется главным образом у детей для стимуляции роста тела и у женщин при остеопрозе.

Препарат вызывает (если вообще вызывает очень слабые явления маскулинизации. Это качество делает его очень хорошим средством для женщин, т. к. при дозе 10–15 мг в день у них крайне редко наблюдаются внешние проявления мужеподобности.

Дибилдеры и пауэрлифтеры любят Оксандролон. Он способствует высокому приросту силы, т. к. возбуждает синтез креатинфосфата в мышечной клетке и при этом не задерживает жидкость.

Я уже устал писать о том, что креатинофосфат синтезируется в печени, а не в мышцах.

Штангисты и силовики, которые не хотят переходить в более тяжелую категорию пользуются этим, т. к. препарат дает им возможность стать сильнее, не прибавляя в собственном весе.

Комбинация Оксандролона и 10–20 мг Халотестина в день показала себя очень эффективно, т. к она дополнительно придает мускулатуре более твердый вид.

Еще более твердый вид придает мышцам правильно подобранная методика тренировок, начиная со сдвоенных сетов Фикса Уиллера и кончая банальной изометрией. Хорошие результаты дает одновременный прием Оксандролона и 120–140 мг Кленбутерола в день.

Хотя сам Оксандролон и не способствует заметному приросту мышц, но зметно усиливает воздействие других стероидов на организм. Препарат особо хорошо комбинируется с Дека-Дураболином, Дианаболом и различными вариантами Тестостерона, которые задерживают жидкость и способствуют сильному росту мышечной ткани.

Сочетание 200 мг Дека-Дураболина в неделю, 500 мг Тестостерона Эанантата в неделю и 25 мг Оксандролона в день вызывает у большинства ателетов хороший прирост силы и массы.

А так же импотенцию, гинекомастию, потерю голоса и манию величия (да-да, такое побочное действие частенько бывает при передозировке стероидов либо андрогенов, но знают об этом только узкие специалисты).

Дека-Дураболин обладает выраженным анаболическим действием и стимулирует синтез протеиновоксандролон повышает силу

Оксандролон не повышает силы. Он усиливает синтез и замедляет распад белка в мышечной ткани.

А тестостерон делает атлетов более агрессивными во время тренировок и Ускоряет регенерацию

Регенерацию чего? Может быть вилочковой железы, которая через месяц после начала введения тестостерона уменьшается в размерах чуть ли не вдвое. Или яичек, которые «после хорошего курса должны становиться меньше». Вот уж что хорошо регенерирует после тестостерона у мужчины, так это молочные железы. У некоторых вырастают так, что приходится удалить хирургическим путем.

Вторая причина по которой так любят Оксандролон заключается в том, что этот препарат не ароматизируется ни при какой дозировке

Не существует анаболических стероидов, не подлежащих ароматизации «ни при какой дозировке». Равно как не существует и андрогенов не подлежащих ароматизации. Если бы даже такие препараты и существовали, это ровным счетом ничего бы не изменило. Любой анаболический стероид (АС) и любой андроген (А) при определенных дозировках уменьшают синтез гондатропина гипофизом. Уменьшение содержания гонадотропина может сопровождаться увеличением содержания пролактина в гипофизе. Соответствующим образом и меняется секреция этих гормонов, а так же их периферические эффекты. Уменьшение в размерах яичек и увеличение в размерах молочных желез будут возникать в такой ситуации в обязательном порядке. С ароматизацией это не будет связано никак. Мне уже надоели бесконечные высказывания автора о том, что и как ароматизирует. Это далеко не самый главный показатель. Как уже упоминалось, определенная часть находящегося в крови тестостерона превращается в эстрогены. Этот процесс ароматизации по разному выражен у разных атлетов в зависимости от предрасположенности к нему. При Оксандролоне мускулатура никогда не приобретает водянистого вида, что позволяет считать препарат хорошим средством при подготовке к соревнованиям. В этой фазе очень важно держать уровень эстрогенов на как можно более низком уровне, т. к. эстрогены программируют организм на задержку воды даже при низкокалорийной диете

Андрогены задерживают воду ничуть не хуже эстрогенов.

В сочетании с диетой Оксандролон помогает сделать мускулатуру твердой и упругой. Твердой и упругой мускулатуру делают тренировки, а не оксандролон.

Хотя сам он не разрушает жиры, но все же играет в этом косвенную роль, т. е. данное химическое вещество подавляет у многих атлетов аппетит.

Большие дозы АС закономерно приводят к уменьшению аппетита и редукции жировой ткани. Вызвано это тем, что они проявляют антагонизм по отношению к глюкокортикоидным гормонам, вызывающим вторичную гиперинсулинемию и как следствие отложение жира и увеличение аппетита. Уменьшение секреции глюкокортикоидов независимо от причин, вызвавших данную реакцию, приводит к уменьшению подкожно-жировой клетчатки.

Оксандролон может вызвать что-то вроде ощущения тяжести в желудке и тошноту, если таблетки приняты во время еды. В инструкции по применению приписывается влияние на деятельность желудочно-кишечного тракта. Поэтому некоторые атлеты рассказывают о регулярных поносах. Хотя это и не очень прияное явление, это все же помогает атлету в его намерениях сжечь жир и выглядеть более поджарым.

Те, кто готовится к соревнованиям либо заинтересован в приростах качественной мускулатуры, должны комбинировать Оксандролон с таким стероидами как Винстрол, Параболан, Мастерон, Примоболан и Тестостерона Пропионат. Сочетение 50 мг Винстрола через день, 50 мг Тестостерона Пропионата каждые 2 дня и 25 мг Оксандролона ежедневно показало себя очень эффективным для этой цели.

Еще одно преимущество Оксандролона к неароматизации в том. Что атлеты, которые страдают повышенным кровяным давлением при сильных андрогенных стероидах заполучают из-за них гинекомастию, с этим препаратом не будут иметь никаких проблем. Сочетание Оксандролона с Дека-Дубаболином является для этой группы спортсменов наилучшей альтернативой, если есть проблемы со здоровьем при применении Тестостеронов, Дианабола или Анаполона 50. Атлеты старше 40 должны использовать преимущественно Оксандролон.

Третья причина, говорящая в пользу Оксангдролона, в том, что это хитмическое вещество не оазывает влияния на выработку собственного тестостерона, т. к. он не подвляет выработку гормонов в организме. Делов том, что Оксандролон не оказывает негативного влияния на дугу «гипоталамус-гипофиз-яички», т. е. при его приеме яички не сигнализируют гипоталамусу о необходимости снижения или полного прекращения выброса гормона, высвобождающего гонадоторопины, и лютенизирующий гормон, как это происходит при приеме большинства анаболических стероидов.

Во-первых, сигнализируют не яички, а сами анаболические стероиды. Во-вторых, они тормозят работу гипофиза, выбрасывающего в кровь гонадотропины. В-третьих, лютеинизирующий гормон является одним из гонадотропинов, поэтому нельзя писать: гонадотропины и лютеинизирующий гормон. Это не придирки. Это элементарщина.

Это особое положение Оксандролона легко объясняется тем, что его действующее химическое вещество не ароматизируется в эстрогены. Доктор Мауро де Паскуале в своей книге «Побочные явления анаболических стероидов — факты, вымыслы и лечение» пишет на стр. 23: «… предполагается. Что эстрогены, возникающие при ароматизации тестостерона и других анаболических стероидов снижают секрецию лютеинизирующего гормона в отделах мозга и гипоталамусе, следовательно, и выработку тестостерона». Американский врач доктор Роберт Керр подтверждает это в книге «Практическое применение анаболических стероидов атлетами»: «Если давать Оксандролон (Анавар) здоровому мужчине в высоких дозах, то в этом случае он не снижает ни количества семени, ни количества спермы и не превращается в эстрогены». Поэтому Оксандролон хорошо комбинировать с Андриолом, т. к. Андриол в дозе до 240 мг в день не ароматизируется и выработка организмом ни в коей мере не затрагивается. Ежедневный прием 280 мг Андриола и 25 мг Оксандролона дают хорошие результаты при приросте силы, а у новичков в стероидных курсах — и мышечной массы без чрезмерной задержки воды, а также без значительного воздействия на выработку собственного тестостерона.

Что касается непосредственно Оксандролона, то хорошие результаты приносят 8-12 табл. В день мужчинам и 5–6 женщинам. Легкое правило ежедневного приема 0.25 мг препарата на килограмм веса оправдало себя на практике. Таблетки, как правило принимают 2–3 раза в день сразу после еды, и тогда достигается максимальное усвоение действующего химического вещества препарата. Те же у кого при приеме препарата возникают желудочно-кишечные расстройства, поступят разумно, принимая таблетки через час-два после еды или вообще откажутся от него.

Т. к. Оксандролон малотоксичен и практически не вызывает побочных явлений, его принимают многие атлеты и на протяжение достаточно долгого промежутка времени. Но не стоит применять его несколько месяцев без перерыва, т. к. он как и почти все оральные стероиды алькулирован по 17-альфа и несет в себе нагрузку на печень.

Оксандролон — средство широкого спктра воздействия, которое часто применяется культуристками. Женщины с чувствительной реакцией на анаболические стероиды достигают хороших результатов комбинируя Оксандролон и Примоболан и/или Кленбутерол, при этом не страдая явлениями маскулинизации. И все же женщины не должны принимать препарат в дозе более 6 таблеток в день, т. к. в противном случае могут возникнуть обусловленные андрогенами побочные эффекты в виде (угрей), снижение тембра голоса, гипертрофия клитора и усиленного выпадения волос.

Пожалуй, самый большой недостоток препарата в его высокой цене. Присутствующий на российском рынке Оксандролон итальянского производства (в упаковке 30 таблеток по 2.5 мг) в среднем по Москве продается по $25–30. Впрочем, возможно скоро Оксандролон сможет быть более доступен для российских ателтов, т. к. есть информация, что китайская фирма Hubei Huangsi Pharmaceuticals будет производить свой Рксандролон, причем в форме таблеток не по 2.5, а по 5 мг. Прогнозируемая цена — подрядка $40 за блистер в 30 таблеток.

К сведению атлетов индийская фирма в.м. Pharmaceuticals уже запустила в производство инъекционный Оксандролон — препарат Оксандролонджект 10 мг/амп.

Anabolics2009 — Стр 25

HTTP://VK.COM/PEPTIDS_MURMANSK

добавлением 2-гидроксиметиленовой группы, которая убирает воздействие 3-а-гидроксистероид дегидрогеназы и увеличивает анаболическую активность и биодоступность.

Эстрогенные побочные эффекты:

Оксиметолон – сильно эстрогенный стероид. Гинекомастия возможна во время курса, особенно на высоких дозах. Задержка воды также может быть проблемой, теряется внешний вид мышц и растет жировая прослойка. Сильные побочные эффекты могут заставить принимать на курсе анти-эстроген типа тамоксифена или кломида. Важно отметить, что оксиметолон не ароматизируется в теле человека. Этот стероид является родственником дигидротестостерона, который также не ароматизируется. Антиароматаза, типа цитадрена или аримидекса – не поможет на курсе с оксиметолоном. Некоторые предполагают, что его эстрогенная активность связана с прогестиновой, как у нандролона. Побочные эффекты могут быть схожими. Медицинские исследования, однако, показали, что прогестагенной активности у оксиметолона нет. Возможно, он просто активизирует эстрогенные рецепторы, подобно метандриолу.

Андрогенные побочные эффекты:

Оксиметолон классифицирован как анаболик, но андрогенные побочные эффекты все еще возможны. Это может быть повышенная жирность кожи, прыщи, рост волос на теле и лице. Высокие дозы, вероятно, вызовут их. Анаболические стероиды могут ухудшить потерю волос по мужскому типу. Женщинам дополнительно нужно помнить о потенциальных вирилизующих эффектах ААС. Сюда могут входить огрубление голоса, нерегулярные месячные, изменение в структуре кожи, рост волос на лице и увеличение клитора. Интересно отметить, что некоторое количество оксиметолона превращается в дигидротестостерон, хотя это происходит не под влиянием 5-а-редуктазы. Оксиметолон по структуре – уже дигидротестостерон, и изменения не могут иметь место. Кроме 17-альфа алкилирования, оксиметолон отличается добавлением 2-гидроксиметиленовой группы. Эта группа может отделяться, оставляя мощный андроген местанолон. Есть мнение, что эта трансформация и увеличивает андрогенную активность препарата. Оксиметолон не вступает в реакцию с 5а-редуктазой и его андрогенность нельзя изменить параллельным применением финастерида или дутастерида.

Побочные эффекты (гепатотоксичность):

Оксиметолон – с17-альфа алкилированный препарат. Это изменение защищает препарат от дезактивации печенью, позволяя большему проценту лекарства попасть в кровоток после перорального приема. Алкилированные ААС могут быть гепатотоксичными. Прием длительное время или в больших дозах может привести к повреждению печени. В редких случаях может развиться опасная для жизни дисфункция. Желательно периодически на курсе посещать врача, чтобы контролировать функции печени. Потребление алкилированных ААС обычно ограничивается 6-8 неделями, чтобы избежать увеличения стресса печени. У оксиметолона есть насыщенное А-кольцо, что несколько уменьшает гепатотоксичность, однако обычно используемые дозы могут иметь сильное влияние. Исследования, в которых 31 пожилой мужчина принимал 50-100мг в день на протяжении 12 недель, показали существенное увеличение АЛТ\АСТ. Второе исследование, в котором 30 пациентов принимали по 50мг ежедневно, показали существенное увеличение уровня глутамилтрансферазы у 17% пациентов, увеличение уровня билирубина у 10%, и увеличения уровня альбумина у 20%. Один из пациентов заболел сложной формой пелиозного гепатита, во время которого в печени образуется множество кист, наполненных кровью, хотя нельзя утверждать, что это действие оксиметолона.

Можно посоветовать применять на курсе добавки, очищающие печень, такие как ливер стабил, лив-52 и эссенциале форте.

Побочные эффекты (сердечнососудистая система):

ААС могут иметь вредное влияние на холестерин крови. Это может быть уменьшение уровня «хорошего» ЛПВП, смещение баланса в сторону риска атеросклероза. Относительное влияние ААС на липиды зависит от дозы, пути введения, типа стероида и уровня сопротивления печеночному метаболизму. ААС могут оказать негативное влияние на давление крови и триглицериды, уменьшить расслабление эндотелия сосудов, спровоцировать гипертрофию желудочков сердца, что потенциально увеличит риск сердечнососудистых заболеваний и инфаркта. Оксиметолон имеет сильное влияние на регулирование холестерина печенью из-за своей неароматизирующейся структуры, структурного сопротивления распаду и пути введения. Исследования в течение 12 недель на пожилых людях, которые принимали по 50-100мг оксиметолона ежедневно показали увеличения уровня ЛПНП и сильное понижение уровня ЛПВП (на 19 и

Как правильно принимать препарат Туринабол, полное описание

 

Туринабол — очень популярный оральный стероид с анаболическим эффектом. В сравнении с Данаболом, Туринабол менее продуктивен относительно набора мышечной массы. В случае с Тестостероном или Данаболом набор мышц сопровождается залитостью, набором жировой массы, а при применении Туринабола будет постепенно набираться только сухая мышечная масса. 

Появление Туринабола. 

Разработан препарат был в 1960-х годах в Германии. Разработчики хотели получить версию, смешав метандростеналон с оксандролоном. Также, целью было достичь того, чтобы препарат не имел побочных эффектов. Они достигли хорошего результата. 

Известные бодибилдеры отмечают хорошую эффективность Туринабола после применения его несколько недель: заметный прирост мышечной массы с незначительной задержкой жидкости, снижение процента жира. Препарат популярен среди любителей и профессиональных спортсменов благодаря тому, что он практически не имеет побочных действий и безопасен для любого организма. 

Туринабол подходит как мужчинам, так и женщинам, благодаря своим свойствам. Правда, доза должна быть немного меньше, чем мужская. 

Данный стероид подойдет для употребления его перед соревнованиями, так как препарат быстро выводится из крови. Спортсменам перед состязаниями необходимо быстро снизить процент жира, не потеряв мышечную массу, в такой ситуации туринабол создаст потрясающий эффект. 

Уровень естественной выработки тестостерона после применения средства восстанавливается примерно через 5 дней и далее становится выше, чем был до курса применения. 

Побочные эффекты: 

— У мужчин при несбалансированном или нерегулярном приеме препаратов может снизится собственный уровень тестостерона, хотя это маловероятно. 
— У женщин при повышенных дозах, больше 20 мг может вызвать вирилизацию.  
— Необходимо следить за состоянием печени, так как возможны нарушения её функций. 

Преимущества туринабола. 

— Высокий эффект анаболика, и низкий андрогенный эффект. 

— Улучшение синтеза протеина в организме. Это и является причиной, по которой туринабол помогает набирать лишь сухую мышечную массу. 

— Увеличение выносливости и силы. 

— Увеличение венозности, придание жесткости мышцам. 

— Быстрая регенерация клеток после тяжелых изнуряющих тренировок. Это дает возможность тренироваться каждый день и не волноваться о плохом восстановлении мышц. 

Курсы и комбинации с Туринаболом: 

1. Соло курс. Подойдет и новичкам, и опытным бодибилдерам. Длительность курса должна быть от 6 до 8 недель, при дозировке 40-60 мг в сутки. Препарат следует принимать два раза в день: утром и днем. 

2. Туринабол + Тестостерон. Дозировка туринабола может быть такая же, как в соло курсе. Тестостерон же употребляется в дозе не более 500 мг за неделю. В случае комбинации Тестостерона с Туринаболом для набора массы подойдет энантат, ципионат, для сушки тела — пропионат. Оптимальная длительность такого курса — 8 недель. 

После курса применение Туринабола должно постепенно снижаться, 15 дней по 50 мг и еще 15 дней по 25 мг. 

Противопоказания:
— Гипертония
— Болезни печени
— Болезни почек
— Онкологические заболевания

При правильном спортивном питании и регулярных силовых тренировках за один курс применения Туринабола можно набрать до 6 килограмм сухой мышечной массы, но это не первая функция препарата. Средство рассчитана на сушку тела при критических мышечных массах. Нормой набора считается 4 кг за 8 недель. 

Пример расписания курса приема. 

Туринабол: 
Неделя 1 — по 2 таблетки в день. 
Неделя 2 — по 3 таблетки в день.
Неделя 3 — по 4 таблетки в день.
Неделя 4 — по 3 таблетки в день.
Неделя 5 — по 2 таблетки в день.
Неделя 6 — ничего. 
Кломид:
Неделя 7 — по 1 таблетки в день.
Неделя 8 — по 1 таблетки в день.

*Кломид — препарат, который нормализует работу органов, восстанавливает организм. 

Тренируйтесь и получайте наилучшие результаты за короткие сроки!

 

«Муж носил меня в туалет – я не могла ходить самостоятельно». Как фитнес может лишить здоровья, нервов и уверенности — citydog.by

История девушки о том, что делать красивое тело – это далеко не романтика, а каторжный труд, который в итоге может подорвать здоровье. И «подорвать» в данном случае – не метафора.

Страшилки о «побочках» стероидных препаратов ходят в каждой качалке: принято считать, что прием анаболиков ведет к проблемам с давлением, печенью, гормональным фоном. Фитнес-инструктор Евгения Матвеенко, на протяжении трех месяцев принимавшая стероиды, рассказывает, почему это опасно и как неожиданно может отреагировать на допинг организм.

«СПОРТ СТАЛ МОИМ НАРКОТИКОМ»

Мы встречаемся с Женей в перерывах между тренировками: короткие шорты, ветровка – одежда сидит как влитая, тело в тонусе, на лице улыбка. За последние три года девушка менялась и внешне, и внутренне – ее вес колебался от 47 до 74 кило. Опыты над собственным телом сказывались не только на здоровье физическом, но и на эмоциональном. В самые сложные времена, когда девушку настигла депрессия, она удалилась из всех соцсетей. Сегодня она вернулась в свой онлайн-журнал, чтобы поделиться опытом и рассказать о «закулисье». Во время разговора с Женей мы обращались к записям в ее ЖЖ, где она откровенно и эмоционально говорит о подводных камнях спортивной жизни.

– Женя, когда ты впервые попала в качалку?

– Я увлеклась спортом в 23 года, сейчас мне 26. Пришла в зал, потому что не складывалась личная жизнь. Несколько раз не удалось выйти замуж – то я уходила, то мужчины уходили от меня. В очередной такой период решила: время, которое раньше я тратила на отношения, надо посвятить чему-то другому. Спорт стал моим наркотиком – мне было классно, я кайфовала от того, что делаю. Я влюбилась в железо и до сих пор неровно к нему дышу. Но спустя три года занимаюсь уже без фанатизма и очень этому рада.

– Помнишь свои первые ошибки?

– Конечно! Я не искала тренера специально – и теперь понимаю, что зря. К своему телу надо допускать только квалифицированных специалистов. С тренером мы познакомились прямо в зале, сложились хорошие отношения, мы подружились. По натуре я человек очень влюбчивый: если мне понравился собеседник, я буду, открыв рот, слушать и внимать. Так было с моим первым инструктором: он открывал для меня новые знания, я впитывала как губка. Даже мысли не было перепроверять и искать другие источники информации. Я сейчас не совсем понимаю, где была моя голова в тот момент, но я безукоризненно выполняла все его наставления.

«7 месяцев я занималась три раза в неделю по 5-6 часов! Я жила в зале. Я фанатела, я качала все, абсолютно все в один день! Думаю, многие понимают, о чем я. Страсть неофита, который нашел свой путь. Потом началась первая и легендарная сушка».

Первая сушка Жени.

Во время сушки три месяца я питалась только яйцами и хлебцами. Иногда в моем рационе появлялись яблоки. О мясе и рыбе и речи не шло – хотя эти продукты нужны. Без выходных я занималась в зале 7 дней в неделю по 3 часа. Я, дилетант в спорте, стала соблюдать жесткий режим профессионального спортсмена. Естественно, это были титанические нагрузки. Причем я тогда еще не готовилась к соревнованиям – просто решила привести тело в норму к отпуску.

 

ПЕРВАЯ СУШКА, ОТКАТЫ И КАТАСТРОФИЧЕСКИЕ СОРЕВНОВАНИЯ

– Да, до сушки я весила 56 килограммов, посушилась – стала весить 53. Была тощая-тощая! Мне казалось, я красавица. Одно «но»: мне ничего не говорили о последствиях. О том, что после сушки бывают откаты, что тело распухает, отекает. «Ну, походишь неделю красивая!» – говорил мне тренер. А я не понимала, почему неделю? Потом все стало на свои места: как только я начала есть обычную еду, тело стало катастрофически быстро меняться, я даже не ожидала. За месяц – плюс 6 кило. Пропал пресс, я стала гладкая. Была такая сочная наполненная девушка. Самое худшее ждало меня впереди.

– Подготовка к соревнованиям?

– Да, все это далось мне нелегко. Я вернулась из отпуска и пошла на курсы по бодибилдингу. В сентябре 2013 года попала в руки к настоящему профи, мастеру своего дела и прекрасному человеку – моему тренеру. С ним я решила готовиться к соревнованиям по бодифитнесу – на все про все было около полугода. Мой инструктор стал мне другом и соратником, но даже ему я не сказала, что гормональный фон уже надломлен – менструаций не было несколько месяцев. Месяца за два до соревнований он об этом узнал и надавал мне по шапке. Не понимаю, как меня не испугали проблемы со здоровьем!

«В ноябре 2013 года я начала готовиться к соревнованиям по бодифитнесу. С ноября по 28 апреля (день соревнований) ушло 17 кг. Начала с 64 кг – вышла с 47 кг».

Наверное, это максимализм – надо было сию секунду готовиться и участвовать. Были цели, и я к ним шла. Я не знаю, что и кому я доказывала! Помню, как в шесть утра делала кардио дома и мчалась в зал. Приезжала одна в пустую тренажерку. Делаю жим, еще один – и навзрыд плачу. Было много интенсива: 30 раз выжать 60 кило – это нелегко. А еще и в голове постоянные вопросы: зачем я здесь? Потому что в жизни что-то не складывалось? Но ведь все уже хорошо! Забылась, увлеклась, что дальше?

– Помнишь день накануне соревнований?

– Хорошо помню ночь. Я выпила сильное мочегонное и буквально спала на унитазе, сводило все мышцы, потому что в организме не было воды. Утром села за руль, повернулась – заели мышцы шеи. Уже на сцене мне было больно ходить на каблуках – сводило пальцы ног. Я сильно нервничала: мышцы я пережгла, колола себе в живот накануне соревнований пептиды, принимала жиросжигатели, но все равно не успела нарастить нужный объем. В общем, взяла тогда титул вице-чемпионки Беларуси по бодифитнесу. Но в моем весе было два человека – я стала второй, если бы было 5 человек, я бы стала пятой. Я была плохо подготовлена, перестаралась.

Ночь перед соревнованиями.

– Выходит, взять личный Эверест не удалось?

– Не сказать, что это было моей целью. Я сама не понимала, к чему иду. Рвала, тянула – а в итоге опустошение. И страшная депрессия. Я вернулась домой и встала на весы – плюс 6 кило за пару дней! Вот и откаты! Понятно, что это вода, но наутро я вся отекла. Голени – самое тонкое место ноги – были огромными. Колодки, а не ноги – ничего не двигалось, было больно ходить. Мое тело долгие месяцы усыхало, а тут раз – и снова наполнилось! Ужасно все болело. Неделю я отдыхала и обжиралась. Я сорвалась. Приехав домой после соревнований, я разом съела тарелку борща, драники со сметаной и закусила килограммом мороженого!

«Я ела и не могла наесться, ела до такой степени, что меня тошнило, я плакала потому, что было так плохо, что больно было дышать. Мой цикл был сбит окончательно. Врачи сказали, что мой организм приближается к менопаузе и если я хочу детей, то надо завязать. Тело распухало на глазах, отеки были такими, что больно было лежать, ходить, дышать…но это все не так страшно, как эмоциональное состояние».

Мне было плохо физически и морально: я ненавидела себя за слабость, за то, что не могу контролировать питание. Постоянное чувство голода не покидало меня: вроде и поела, но все равно хотелось еще.

– Как ты с этим боролась?

– Никак! Я ела. Могла контролировать себя день, два. Потом начинались такие «зажоры», что просто ужас. Булки, мороженое… Я прятала в комнате заначки – мармелад и конфеты – и точила их перед сном. Пол-литра меда с печеньем? Запросто! Мне было стыдно, но остановиться я не могла.

 

СТЕРОИДЫ И ПОДОРВАННОЕ ЗДОРОВЬЕ

– Применить стероиды – это было твое решение?

– Да. Сама не знаю, как пришла к этому, – всегда боялась таких препаратов. Но мне хотелось результата. Впереди были еще одни соревнования, я решила участвовать. Тренер знал о моем желании применить анаболики. Была долгая беседа, но на все его предупреждения я как безумная отвечала: «Хочу, хочу мышцы!» Мне расписали курс оксандролона и примоболана на три месяца – раз в неделю уколы и таблетки. Типа какие-то мягкие препараты – но я не уверена в этом, и мой тренер говорит, что мягких препаратов не бывает: ты либо курсуешь, либо не курсуешь, потому что один-два укола дадут краткосрочный эффект.

Я укололась первый раз. Пришла домой, и мама бегала вокруг меня и фотографировала мои плечи. Она была удивлена – тело так быстро изменилось! Мама все знала, поддерживала меня и переживала за меня. Курс шел, я менялась. Было красиво, везде была натянутая кожа, мышцы – словно резинки. Вообще, я была похожа на резиновую куклу – куда ни ткни, везде пружинило.

«Я была счастлива, я была уверена, что все идет как надо. К концу курса я весила 68 кг. Это было красиво. Я была как резиновая, и, казалось, если тыкнуть в меня пальцем, я лопну))) В общем, я тащилась!»

Я быстро наполнялась, росли веса – я присела с весом в 120 кило при своем весе в 56, даже видео сняла. Эйфория! Я так гордилась!

– Когда ты почувствовала, что что-то идет не так?

– Однажды защемило 3-й и 4-й позвонки, стали неметь руки по ночам, стали болеть все суставы, локти, пальцы. Я даже не знала, что эти суставы у меня есть! Ныло все. Стероиды дают рост мышцам, но мы же организм, растет все – кости, внутренние органы и, конечно же, мышцы. Живот у меня не втягивался, потому что внутри все стало больше, чем надо. Изменился голос. Я думала, что это никогда не закончится, но все равно курсовала. Люди видели, как быстро я меняюсь. Но мне ужасно стыдно было сказать, что я колю стероиды. Все это скрывают. Без допинга подготовиться к соревнованиям невозможно: все применяют какие-то препараты, но никто об этом не говорит.

«Я стала заложницей самой себя… Я понимала, что должна продолжать качаться, но я так устала от гонки. Я не хотела заниматься, я не могла подойти к железу, меня все раздражало, я постоянно злилась».

– Кто помог тебе «слезть»?

– Мой нынешний муж. Я познакомилась с ним как раз в этот период. Он любил меня в любом весе, даже когда на весах было за 70. В это время я продолжала срываться на еду: любые шуточки насчет пищи я воспринимала очень остро. А однажды заболела. Температура держалась долго: все анализы были в норме, но организм сдался. Иммунитет после курса снизился. Мои гормоны «обленились» после трехмесячной стимуляции и перестали работать. Я чувствовала себя ужасно. Муж предложил мне отдохнуть и ничего не делать какое-то время. Я согласилась.

«38 держалась неделю, потом падала, потом опять поднималась и так целый месяц. Были дни, когда Саша (муж) носил меня в туалет, я просто не могла ходить самостоятельно. Я сдала всевозможные анализы, но они показывали, что я здорова. Саша уговорил меня отдохнуть, не заниматься до тех пор, пока я сама не захочу. Весь декабрь 2014 года 24/7 я ела только одно сладкое, не качалась и жирела, я стала весить 74 кило».

– Было страшно?

– Очень. Спасибо супругу, я не спала ночами, он возился со мной. Именно тогда я поняла свои ошибки. (На секунду Женя замолкает – кажется, каждое слово дается ей с трудом.) Я экономила силы, стала пить витамины, хоть как-то себя поддерживать.

Женя с мужем, декабрь 2014-го.

Гинеколог назначила мне оральные контрацептивы, цикл потихоньку восстанавливается. Мы очень хотим детей, но пока не получается. Хотя знаю, что все будет отлично! Сейчас я занимаюсь у потрясающего тренера.

«Пыталась найти общий язык с телом и научиться договариваться со своими мозгами, но все мои попытки были тщетны. Продолжала заниматься, срываться, плакать, злиться. С каждым срывом отчаяние росло, и я поняла: мне нужна помощь. В мае я обратилась к Владимиру Ван-Ли. Знаете, как интересно было попасть к человеку, который занимается тем же, чем и ты сам? Было сложно стать клиентом. Все тренеры, которые поистине любят свою работу, – отличные психологи, и то, как они ищут подход к человеку, дорогого стоит. Но я-то того же поля ягода».

У него своя методика, все тренировки с изюминкой. Пока все идет как надо!

О ФИТОНЯШАХ, МОДЕ И ЗДОРОВЬЕ

– Как изменились за эти три года твои представления о красоте?

– Раньше мне нравились худые, сейчас я люблю крепкие тела. Мне нравится, когда мышцы на ногах видны, когда хорошо «читаются» плечи. Сейчас я вешу 62 килограмма, пять кило планирую сбросить, но не ставлю цель убрать вес – просто хочу быть в форме.

– Что ты думаешь о фитоняшках?

– Девочки с картинки с высушенными телами. Эффект после сушки краткосрочен – тело всегда меняется, и надо просто по-особому строить свою жизнь, чтобы иметь такой эффект все время. Многие женщины в профессиональном спорте имеют такие проблемы, с которыми столкнулась я. Нет менструации, а значит, нет возможности родить.

– Выходит, внешне – красивая женщина, а физиологически – не совсем?

– Именно. Трудно определить, кто прячется под этой горой мышц.

– На что стоит обратить внимание тем, кто впервые пришел в зал?

– Советую много читать и изучать. Думать головой. И искать квалифицированного инструктора.

– Что ты думаешь о нынешней моде на качалки?

– Мода временна, надо просто знать, для чего ты это делаешь. Здорово, если все ради поддержания тела в тонусе, ради здоровья. Хуже, когда перегибаешь палку, как я, когда тебя несет. Надо всегда думать о последствиях. Если включать мозги – все будет в порядке.

«Большая половина пути пройдена, осталось совсем немного. Все это я хотела написать, когда все закончится, но подумала, что мне самой будет интереснее выбираться из этой ямы, когда все знают. Я знаю, что многие сейчас, прочитав это, даже ни сном ни духом не были в курсе всего происходящего со мной. Все, что случилось, – это опыт. Опыт, который позволил мне понять себя, принять себя и пройти этот путь. Все наши ограничения, вся наша боль и все наши проблемы – в голове. Как только ты сумеешь научиться жить в мире со своим внутренним “я” и дружить с головой – ты решишь свои проблемы».

Перепечатка материалов CityDog.by возможна только с письменного разрешения редакции. Подробности здесь.

Фото: CityDog.by, архив героини.

Еще по этой теме:

Красота на грани болезни: истории качков

«…Очень жестко на самом деле. Но это логично. В организме столько тестостерона, что его, естественно, нужно куда-то выплеснуть. Некоторым парням на курсе срывает крышу в плане секса. Правда, потом все может стать как-то не очень… Ну, ты понимаешь, о чем я…» Onliner. by рассказывает о стройке собственного тела, главная задача во время которой — не умереть.

Клим Шрубов профессионально занимается таэквондо. Третье место на чемпионате Европы плюс несколько побед в чемпионате Беларуси — коллекция спортсмена наполнена приятным металлом. Клима радует нынешний массовый энтузиазм относительно здорового образа жизни, но не радует его традиционный перебор.

— Понимаешь, ребята, которые вообще не разбираются в теме, читают про «фарму» в интернете и начинают лупить ее со старта в таких дозировках, что побочных эффектов никак не избежать.

«Фарма» — сокращенное от «фармакология». В реальности новоявленного адепта ЗОЖа ее нет. Поход в тренажерный зал на первых порах — сплошное удовольствие. Новички хорошо «растут». Правда, потом традиционно возникает желание большего.

— Если кто-то хочет быстро нарастить мышечную массу, нужно увеличивать количество потребляемого белка, — говорит Татьяна Ловец, бывшая баскетболистка, а ныне один из немногих в стране дипломированных тренеров по физподготовке (профессии девушка училась в Швеции).Вообще, я за здоровое питание без добавок. Да, если нет возможности нормально поесть, можно выпить протеин (концентрированный белок) или гейнер (белково-углеводную смесь). Но все равно лучше носить с собой контейнеры, чтобы не пропускать приемы пищи. Так что все эти ребята, которые приходят в офис с этажами контейнеров, — не сектанты какие-нибудь, а нормальные посетители тренажерных залов. Просто рост мышц требует хорошего режима питания. И пропускать приемы пищи нежелательно.

Культу своего тела сопутствует культ еды. Человек, который твердо решил «расти», ест, ест, ест и думает, чего бы еще ему съесть. Из желания стать как можно больше как можно быстрее некоторые ребята ударяются в легкую фармакологию.

— Люди, которые хотят быстро нарастить мышцы, покупают аминокислоты и изоляты и начинают закидывать все это в себя вместо нормального питания. Типичная ошибка новичка, — продолжает Татьяна Ловец. — Но что касается спортпита, никаких побочных эффектов не существует. Порция гейнера или протеина может заменить один прием пищи. Да, при употреблении спортивного питания новичок ничем не рискует. Риск начинается с анаболиков.

У любого организма есть потолок. Достигнув его, можно шесть лет подряд тягать дикие веса и никак не прибавлять в мышечной массе. Тогда в жизни бодибилдера наступает пора выбора. Артем Змитрович сделал его в пользу мышц. Их у этого парня внушительно много.

— У каждого есть генетика, — объясняет Артем. — И при этом у каждого имеется возможность сломать ее различными препаратами. Честно, я не «стремался», решаясь на прием химии. Все-таки с шести лет занимался гимнастикой, борьбой, а потом еще и лучшим белорусским видом спорта — армией. В общем, наработал хорошую базу и уперся в потолок. Вот ради роста мышц и начал принимать разные стероиды.

Артем работает начальником охраны в одном из минских ночных клубов. Это просто огромный человек. Вряд ли кто-то из посетителей мероприятий, на которых работает Змитрович, решается безобразничать в его присутствии.

— Утвердиться в этой сфере можно только за счет веса, — объясняет мотивацию своего роста Артем. — Согласись, если к тебе в кабинет заходит огромный человек, мыслей вроде «Как бы его кинуть?» становится меньше. Мы на подсознательном уровне уважаем больших людей.

Со временем в лексиконе почти любого посетителя любого тренажерного зала появляется триада из слов: «дека», «суст» и «метан» («нандролон», «сустанон», «метандростенолон»). Это названия препаратов, на которых базируется вся химия качков.

— Если начинать разговор о препаратах стероидного плана, производных от тестостерона вроде нандролона и так называемого гормона роста, нужно учитывать возможные побочные действия, — говорит доктор национальной сборной Беларуси по гандболу Виктор Белый. — Проблемы, обусловленные неконтролируемым использованием этих препаратов, выявляются через какое-то время. Грубо говоря, о последствиях люди начинают думать только после их обнаружения.

— Почти любая «побочка» возникает от незнания, — рассказывает Шрубов.Незнания особенностей препарата и своего тела. Реакция может быть какой угодно. Если опытный человек видит в раздевалке чью-то спину в угрях, больше похожую на поверхность Луны, то сразу же отмечает для себя: паренек по-любому баловался «декой». Понятное дело, только если это не болезнь какая-нибудь.

В компании опытных бодибилдеров, увлеченных беседой, постоянно возникает желание «гуглить». Присутствует ощущение, будто находишься на собрании президентских стипендиатов в области химии.

— Я много чего принимал, — продолжает Змитрович. — И оксиметолон (разновидность «метана»), и сам «метан», и сустанон, и пропионат, и оксандролон. Препаратов для наращивания массы очень много — штук под сто примерно. Что-то влияет на почки, что-то — на эндоморфины, что-то — на сахар. В общем, вариантов «побочки» просто море.

— Есть более-менее безобидный оксандролон, — подхватывает Шрубов, который выступает против стероидов и соревнуется без их использования.Правда, если перебрать, откажут яички. Так что степень безобидности оксандролона весьма условная. Если есть предрасположенность к облысению, часть волос на голове обязательно будет потеряна. От некоторых стероидов пролонгированного действия вроде пропионата может случиться гипертония. Плюс гинекомастия, это образование жира на сосках по женскому типу. Просто тестостерон конвертируется в эстрогены — женские гормоны. Потом хирурги режут тебе соски, чтобы убрать ненужные образования.

— Существует понятие безопасности и эффективности, — остерегает доктор Белый. — Они должны сочетаться наиболее оправданно. Если мы говорим об аминокислотах, то да, в их применении есть рациональное зерно. Если мы говорим о гейнере, протеине и элькарнитине — то же самое. Что касается всего остального, то надо думать, есть ли смысл в применении препаратов с точки зрения любительского спорта. Человеку либо дано от природы, либо нет. Если он будет работать, получит результат. Химия этого результата не заменит.

И тем не менее химией сейчас активно пользуются в тренажерных залах. Ребята, которые все-таки садятся на стероиды, любят упоминать в своей речи понятие «курс». Это срок приема того или иного препарата. Стандартный курс обычно занимает восемь недель.

— Главная ошибка почти любого бодибилдера — неправильный выход из курса, — делится мыслями Змитрович. — Наверное, 95% белорусских качков страдают от этого. Я сидел на тестостероновых препаратах. Без поступления извне тестостерон в организме доходит максимум до отметки в 35. Но как только ты начинаешь что-то принимать, показатели добивают до 150. Понятное дело, собственный тестостерон при этом понижается практически до нуля.

Тело демонстрирует такую же реакцию при курении. Как только никотин начинает поступать извне, организм перестает вырабатывать свой собственный и требует добавки. Это формирует зависимость.

— Исходя из перераспределения тестостерона у бодибилдеров появилось понятие «яма», — продолжает Артем.Это период времени после курса. Яму нужно очень грамотно прорабатывать препаратами, которые помогают вернуть собственный тестостерон в норму. Естественно, главная беда во время ямы — плохая эрекция. Пока ты сидишь на тестостероне, который активно поступает извне и зашкаливает по всем показателям, у тебя все в этом плане замечательно. Но организм все равно будет какое-то время восстанавливаться после химии. В зависимости от длительности курса это срок от двух недель и выше, максимум до пары-тройки месяцев. Это «вялый» период. Так что нужно принимать препараты, которые возбуждают собственный тестостерон, чтобы все вернулось в норму.

Теоретически возможны курсы с минимальными побочными последствиями. Но это целая наука.

— Надо понимать, что все эти препараты очень сильно бьют по «гормоналке» и мозгам, — рассказывает о своей самой большой яме Змитрович. — У меня был курс, во время которого я употреблял по 650 миллиграммов действующего вещества в неделю. «Суст», энантан, «дека», оксиметолон — почти десять недель. Я набрал 14 килограммов, 7 из которых — чистое мясо. Но вместе с силой росла и злость. Все же принимал тренболон ацетат, который дает большой подъем давления — вот и стал дико возбудимым. Неправильные выражения, повышенный голос, мат — тут же реагировал агрессией. Я закончил курс и начал принимать блокаторы с опозданием — в итоге получилась яма длиной почти в месяц. В голове — постоянная агрессия, в теле — вялость. Настроения почти нет. У меня все силовые показатели упали килограммов на 20. Плюс когда выгоняешь химию, начинают болеть суставы, да и все тело вместе с ними.

Ясное дело, купить безобидный гейнер или протеин можно практически везде. Продажа спортивных добавок в условиях ЗОЖ-тренда — хороший бизнес. Но откуда качки достают сильнодействующие медицинские препараты?

— Понимаете, есть такое государство — Россия, — замечает Белый. — Тот же гормон роста под коммерческим названием «Джинтропин» в Беларусь тащат оттуда. Просто в России не настолько жестко контролируется рынок сбыта.

— Один курс для профессионала может стоить $25 тыс., — делится Змитрович. — $25 тыс.! Огромные бабки. Для сравнения: мои курсы обходятся в районе 500 «баксов». Это максимум. Препараты бывают таблетированными и инъекционными. Не хочешь колоться — жри. Не хочешь жрать — разводи порошок. Все зависит от желания и денег. Порошки стоят дороже таблеток. Инъекции стоят дороже порошков. Таблетки стоят дешевле всего, потому что бьют по печени.

Для справки: 100 таблеток «метана» по 10 миллиграммов обойдутся в районе $16. То есть не вся химия дорогая. И вполне понятно, что решившийся на употребление стероидов бодибилдер не может проконсультироваться у врача. Тогда на помощь приходят всемогущий Google и тематические форумы.

— Одни любители читают, что в интернете написали другие любители, — удивляется доктор. — Я пару раз залазил на форумы и немного сходил с ума, когда начинал вчитываться. Народ рекомендовал колоть 5—7—10 инъекций препарата «Ретаболил» с интервалом в неделю-полторы. Самое безопасное последствие подобного приема — холестатический гепатит. То есть конкретные изменения в печени. В лучшем случае они обратимы, в худшем — человеку на всю жизнь остается боль в правом подреберье (там находится печень). Бодибилдер описывает свои успехи на форуме. Правда, при появлении первых же проблем со здоровьем в голове такого качка возникает четкая мысль: «Прямо сейчас мне важнее сходить не на форум, а к врачу». И дальше становится вообще невесело. Про свои неудачные опыты с «фармой» в интернете мало кто пишет.

Ребята, которые давно сидят на стероидах, прекрасно понимают это.

— Когда начинаешь большими дозами «хавать», допустим, оксандролон (это примерно как пять таблеток «метана» за раз), тут же раздуваешься, — делится Змитрович. — Далее начинаются логичные процессы. Вывод жидкостей из организма осуществляется намного хуже. Появляются проблемы с прыщами и почками, одышка, давление… Ясное дело, любой препарат, которым сейчас пользуются качки, создавался не для них, а для больных людей. Например, пациентам, находящимся в коме, вводят «деку» или жидкий «метан», чтобы не образовывались пролежни, а мышцы без движения оставались в тонусе.

— У женщин начинается повышение тестостерона, — довершает список ужасов Шрубов. — Тестостерон — мужской гормон. Начинается рост волос в местах, в которых наблюдать его не хотелось бы. Плюс болезни матки, искусственная менопауза, маскулинизация: усы, голос меняется…

Профессионалы любят шутить на тему самого «химического» вида спорта. Больше всего достается легкоатлетам. Хотя, говорят, даже шахматисты принимают амфетамин, чтобы расшевелить мозг.

— Я всю свою жизнь занимался спортом, соревновательность из моей башки уже не выбьешь, — объясняет свое желание быть еще больше Змитрович. — Я совру, если скажу, что использую стероиды чисто для себя. Все-таки любой человек считает себя красивым. Изменение собственного тела начинается только под воздействием внешних факторов. Согласись, ты же не станешь колоть себе инсулин в какой-нибудь деревне, где твои «банки» потом будут рассматривать только кони, 90-летние бабки да козы? Всем хочется внимания и уважения. Когда я пришел в качалку, весил 82 и жал до 100 килограммов. Сейчас я вешу 104 и в рабочей проходке жму 120, 130, 150 и 170 на шесть раз. Хотелось бы больше.

— Я окончил БГУФК, — подхватывает профессиональный таэквондист. — Нам читали лекции о стероидах. Наслушались много чего. Если бы я захотел, то за три месяца раздулся бы «метаном» до 100 килограммов, хотя сейчас в сухой мышечной массе вешу 81—82. Но зачем? Думаю, это как татуировки. Одну набил — и затягивает. Ребята, которые сидят на курсе, чувствуют себя суперменами. Тестостерон же бьет в голову. Все отлично растет. Размер одежды постоянно увеличивается. Ходишь как конь, все на тебя смотрят. И все равно нельзя вырасти в Шварца за счет стероидов. Глупо думать, что можно чего-то добиться, сидя дома на химии. Многие ребята жрут «метан» и не понимают, зачем это делают, — просто жрут, сидят и ждут, что вырастут «битки».

— Любая из фармакологических добавок, будь то спортивное питание или медицинские препараты посерьезнее, не даст результата без усилий человека, который их принимает, — соглашается доктор.Нужно хорошо питаться и грамотно тренироваться.

Защитники умеренной и не очень умеренной химии любят повторять, что употреблять таблетки лучше, чем заливаться алкоголем. Мол, в пиве есть фитоэстроген — женский гормон, который в больших количествах разрушает мужское начало.

— Да, это лучше, чем бухать, — продолжает Клим. — От алкоголя и наркотиков нагрузка на печень все равно будет большей, чем от курса препаратов. И все равно я не понимаю, зачем химия обычным людям. Для них это просто ерунда. Работнику офиса, который ходит в зал, чтобы сделать себе аватарку посексуальнее, точно не надо садиться на курс. Это чревато слишком большим количеством проблем. Стероиды переписывают ДНК. У качков, которые сидели на курсе, в будущем вряд ли родится мальчик. Серьезно. Ученые говорят, что подавляющий процент детей бодибилдеров, которые принимали стероиды, — девочки.

— Интерес к спортивной фармакологии так или иначе существовал всегда, — объясняет нынешнюю популярность «фармы» Белый.Просто в последние годы она стала более доступной. Появилась возможность реализовать собственные потребности в плане тела с помощью химии. Это отнюдь не здорово. Но это соблазнительно. Элементарный и действенный маркетинг: люди предлагают вам сделать себе тело за два месяца до пляжного сезона. Соблазн просто супер. Но не бывает действий без последствий.

— Давай возьмем практически любой зал, — предлагает напоследок Змитрович. — Из парней, которые системно посещают его, процентов 80 гарантированно сидят на курсе. Еще процентов 10 врут, говоря, что не сидят на курсе. Оставшиеся процентов 10 действительно ничего не «хавают» и просто тягают гантельки…

Перепечатка текста и фотографий Onliner.by запрещена без разрешения редакции. [email protected]

Anavar Oral: использование, побочные эффекты, взаимодействия, изображения, предупреждения и дозировка

См. Также раздел «Предупреждение».

Могут возникнуть тошнота, рвота, головная боль, изменение цвета кожи, повышенный / пониженный сексуальный интерес, жирная кожа, выпадение волос и угри. Если какой-либо из этих эффектов сохраняется или ухудшается, немедленно сообщите об этом своему врачу или фармацевту.

Помните, что ваш врач прописал это лекарство, потому что он или она посчитали, что польза для вас больше, чем риск побочных эффектов.Многие люди, принимающие это лекарство, не имеют серьезных побочных эффектов.

Немедленно сообщите своему врачу, если произойдет какой-либо из этих маловероятных, но серьезных побочных эффектов: психические изменения / изменения настроения (например, беспокойство, депрессия, повышенный гнев), проблемы со сном / храп.

Если вы мужчина, немедленно сообщите своему врачу, если возникнут какие-либо из этих маловероятных, но серьезных побочных эффектов: проблемы с мочеиспусканием, набухание / болезненность груди, слишком частые / продолжительные эрекции.

В редких случаях у мужчин может быть болезненная или длительная эрекция, длящаяся 4 или более часов.Если это произойдет, прекратите использование этого препарата и немедленно обратитесь за медицинской помощью, иначе могут возникнуть необратимые проблемы.

Это лекарство может снизить выработку спермы, что может снизить мужскую фертильность. Обратитесь к врачу для получения более подробной информации.

Если вы женщина, немедленно сообщите своему врачу, если возникнут какие-либо из этих маловероятных, но серьезных побочных эффектов: снижение голоса, охриплость, необычный рост волос на лице / теле, увеличение клитора, нерегулярные менструальные периоды.

Это лекарство может вызвать задержку избыточной воды в организме (отек).Это может увеличить риск сердечной недостаточности. Немедленно сообщите своему врачу, если возникнут какие-либо из этих маловероятных, но серьезных признаков задержки воды или сердечной недостаточности: одышка, отек лодыжек / стоп, необычная усталость, необычное / внезапное увеличение веса.

Очень серьезные аллергические реакции на этот препарат возникают редко. Однако немедленно обратитесь за медицинской помощью, если вы заметили какие-либо симптомы серьезной аллергической реакции, в том числе: сыпь, зуд / отек (особенно лица / языка / горла), сильное головокружение, затрудненное дыхание.

Это не полный список возможных побочных эффектов. Если вы заметили другие эффекты, не перечисленные выше, обратитесь к врачу или фармацевту.

В США —

Обратитесь к врачу за медицинской консультацией по поводу побочных эффектов. Вы можете сообщить о побочных эффектах в FDA по телефону 1-800-FDA-1088 или на сайте www.fda.gov/medwatch.

В Канаде — Обратитесь к врачу за медицинской консультацией по поводу побочных эффектов. Вы можете сообщить о побочных эффектах в Министерство здравоохранения Канады по телефону 1-866-234-2345.

Использование, побочные эффекты, взаимодействия и изображения таблеток

ВАЖНАЯ ИНФОРМАЦИЯ: КАК ИСПОЛЬЗОВАТЬ ДАННУЮ ИНФОРМАЦИЮ: Это сводка и НЕ содержит всей возможной информации об этом продукте.Эта информация не гарантирует, что этот продукт безопасен, эффективен или подходит для вас. Эта информация не является индивидуальным медицинским советом и не заменяет совет вашего лечащего врача. Всегда спрашивайте у своего лечащего врача полную информацию об этом продукте и ваших конкретных медицинских потребностях.

В редких случаях этот препарат вызывает серьезные, иногда со смертельным исходом, проблемы с печенью, включая печеночную недостаточность, кисты печени и опухоли печени. Немедленно сообщите своему врачу, если у вас есть какие-либо признаки проблем с печенью, такие как пожелтение глаз / кожи, темная моча, необычная усталость или внезапная / постоянная боль в животе / животе.Этот препарат также может повлиять на уровень холестерина и повысить риск проблем с сердцем или кровеносными сосудами (ишемическая болезнь сердца). Ваш врач будет внимательно следить за уровнем холестерина.

Этот препарат используется для того, чтобы помочь людям восстановить вес, который они потеряли из-за определенных заболеваний (таких как хирургическое вмешательство, хроническая инфекция, травма, длительный прием кортикостероидных препаратов, таких как гидрокортизон / преднизон). Он также используется для облегчения боли в костях из-за потери костной массы (остеопороза).Оксандролон принадлежит к классу препаратов, известных как анаболические стероиды. Эти препараты похожи на мужские гормоны, вырабатываемые организмом.

В этом разделе описаны применения этого препарата, которые не указаны в утвержденной профессиональной маркировке препарата, но могут быть прописаны вашим лечащим врачом. Используйте этот препарат для лечения состояния, перечисленного в этом разделе, только в том случае, если оно было предписано вашим лечащим врачом. Это лекарство также можно использовать для увеличения роста у девочек и молодых женщин с определенным генетическим заболеванием (синдром Тернера).

Принимайте это лекарство внутрь обычно 2–4 раза в день или по указанию врача. При расстройстве желудка его можно принимать с пищей или молоком. Дозировка зависит от вашего состояния здоровья и реакции на лечение. Чтобы получить от него максимальную пользу, регулярно принимайте это лекарство. Чтобы помочь вам запомнить, принимайте его в одно и то же время каждый день. Этот препарат обычно используется только для краткосрочного лечения. Неправильное использование или злоупотребление анаболическим стероидом может вызвать серьезные побочные эффекты, такие как сердечные заболевания (включая сердечный приступ), инсульт, заболевания печени, психические проблемы / проблемы с настроением, ненормальное поведение, связанное с поиском лекарств, или неправильный рост костей (у подростков). Не увеличивайте дозу и не используйте этот препарат чаще или дольше, чем предписано. При неправильном использовании или злоупотреблении анаболическим стероидом у вас могут возникнуть симптомы отмены (например, депрессия, раздражительность, усталость), когда вы внезапно прекратите прием препарата. Эти симптомы могут длиться от недель до месяцев. Сообщите врачу, если ваше состояние не улучшится или ухудшится.

См. Также раздел «Предупреждение».

Возможны тошнота, рвота, головная боль, изменение цвета кожи, повышенный / пониженный сексуальный интерес, жирная кожа, выпадение волос и угри.Если какой-либо из этих эффектов сохраняется или ухудшается, немедленно сообщите об этом своему врачу или фармацевту. Помните, что ваш врач прописал это лекарство, потому что он или она посчитали, что польза для вас больше, чем риск побочных эффектов. Многие люди, принимающие это лекарство, не имеют серьезных побочных эффектов. Немедленно сообщите своему врачу, если возникнут какие-либо из этих маловероятных, но серьезных побочных эффектов: психические изменения / изменения настроения (например, беспокойство, депрессия, повышенный гнев), проблемы со сном / храп. Если вы мужчина, немедленно сообщите своему врачу, если произойдет какой-либо из этих маловероятных, но серьезных побочных эффектов: проблемы с мочеиспусканием, набухание / болезненность груди, слишком частые / продолжительные эрекции.В редких случаях у мужчин может быть болезненная или продолжительная эрекция, длящаяся 4 и более часов. Если это произойдет, прекратите использование этого препарата и немедленно обратитесь за медицинской помощью, иначе могут возникнуть необратимые проблемы. Если вы женщина, немедленно сообщите своему врачу, если произойдет какой-либо из этих маловероятных, но серьезных побочных эффектов: снижение голоса, охриплость, необычное выражение лица. / Рост волос на теле, увеличенный клитор, нерегулярные менструации. Это лекарство может вызвать задержку избыточной воды в организме (отек). Это может увеличить риск сердечной недостаточности.Немедленно сообщите своему врачу, если возникнут какие-либо из этих маловероятных, но серьезных признаков задержки воды или сердечной недостаточности: одышка, отек лодыжек / стоп, необычная усталость, необычное / внезапное увеличение веса. Очень серьезная аллергическая реакция на этот препарат возникает редко. Однако немедленно обратитесь к врачу, если вы заметили какие-либо симптомы серьезной аллергической реакции, включая: сыпь, зуд / отек (особенно лица / языка / горла), сильное головокружение, затрудненное дыхание. Это не полный список возможных побочных эффектов. последствия.Если вы заметили другие эффекты, не перечисленные выше, обратитесь к врачу или фармацевту. В США — обратитесь к врачу за медицинской консультацией по поводу побочных эффектов. Вы можете сообщить о побочных эффектах в FDA по телефону 1-800-FDA-1088 или на сайте www.fda.gov/medwatch. В Канаде — позвоните своему врачу для получения медицинской консультации о побочных эффектах. Вы можете сообщить о побочных эффектах в Министерство здравоохранения Канады по телефону 1-866-234-2345.

Перед использованием оксандролона сообщите своему врачу или фармацевту, если у вас на него аллергия; или если у вас есть другие аллергии. Этот продукт может содержать неактивные ингредиенты, которые могут вызвать аллергические реакции или другие проблемы. Поговорите со своим фармацевтом для получения более подробной информации. Это лекарство не следует использовать при определенных заболеваниях. Перед использованием этого лекарства проконсультируйтесь со своим врачом или фармацевтом, если у вас есть: рак груди у мужчин, рак простаты, определенный минеральный дисбаланс (высокий уровень кальция в крови). Перед использованием этого лекарства сообщите своему врачу или фармацевту свою историю болезни, особенно: заболевания (например, сердечная недостаточность, боль в груди, сердечный приступ), проблемы с печенью, проблемы с почками, другие виды рака, высокий уровень холестерина, высокое кровяное давление, увеличенная простата, проблемы с дыханием (например, апноэ во сне, хроническая обструктивная болезнь легких — ХОБЛ) , сахарный диабет.Если у вас диабет, этот продукт может снизить уровень сахара в крови. Регулярно проверяйте уровень сахара в крови в соответствии с указаниями и сообщайте о результатах своему врачу. Немедленно сообщите своему врачу, если у вас есть симптомы низкого уровня сахара в крови, такие как внезапное потоотделение, дрожь, учащенное сердцебиение, голод, помутнение зрения, головокружение или покалывание в руках / ногах. Вашему врачу может потребоваться скорректировать лекарство от диабета, программу упражнений или диету. Сообщите своему врачу, если вы прикованы к постели (не можете ходить) в течение длительного времени при использовании этого лекарства.Ваш врач может контролировать уровень кальция в крови, чтобы предотвратить проблемы.При применении этого препарата у пожилых людей рекомендуется соблюдать осторожность, поскольку они могут подвергаться большему риску возникновения проблем с простатой / печенью и отека рук / ног.При применении этого препарата у детей рекомендуется соблюдать осторожность. потому что может быть нарушен рост костей, что приведет к снижению роста взрослого человека. Врач вашего ребенка будет следить за ростом и развитием костей во время лечения. Это лекарство может повлиять на фертильность у мужчин. За подробностями обратитесь к врачу. Это лекарство нельзя использовать во время беременности.Это может нанести вред нерожденному ребенку. Обсудите с врачом использование надежных средств контроля над рождаемостью (например, презервативов, противозачаточных таблеток). Если вы забеременели или думаете, что беременны, немедленно сообщите об этом своему врачу. Неизвестно, проникает ли этот препарат в грудное молоко. Это может повлиять на выработку молока и нанести вред грудному ребенку. Кормление грудью при применении этого препарата не рекомендуется. Перед кормлением грудью проконсультируйтесь с врачом.

Ваш врач или фармацевт, возможно, уже знают о любых возможных взаимодействиях с лекарствами и могут следить за вами на предмет их выявления.Не начинайте, не прекращайте и не изменяйте дозировку любого лекарства, прежде чем проконсультироваться с врачом или фармацевтом. Перед использованием этого лекарства сообщите своему врачу или фармацевту обо всех рецептурных и безрецептурных / растительных продуктах, которые вы можете использовать, особенно о: «(например, варфарин). Это лекарство может мешать определенным лабораторным тестам (включая тесты функции щитовидной железы), что может привести к ложным результатам тестов. Убедитесь, что персонал лаборатории и все ваши врачи знают, что вы принимаете этот препарат. Этот документ не содержит всех возможных взаимодействий.Поэтому перед использованием этого продукта расскажите своему врачу или фармацевту обо всех продуктах, которые вы используете. Держите при себе список всех ваших лекарств и поделитесь им со своим врачом и фармацевтом.

Если у кого-то произошла передозировка и наблюдаются серьезные симптомы, такие как обморок или затрудненное дыхание, позвоните в службу 911. В противном случае немедленно позвоните в токсикологический центр. Жители США могут позвонить в местный токсикологический центр по телефону 1-800-222-1222. Жители Канады могут позвонить в провинциальный токсикологический центр.

Не передавайте это лекарство другим людям. Разглашение информации является нарушением закона. Необходимо периодически проводить лабораторные и / или медицинские тесты (например, подсчет эритроцитов, функциональные тесты печени, уровень холестерина в крови, анализ ПСА), чтобы контролировать ваш прогресс или проверять наличие побочных эффектов. Обратитесь к врачу для получения более подробной информации.

Если вы пропустите прием, примите его, как только вспомните. Если это близко к времени приема следующей дозы, пропустите пропущенную дозу. Примите следующую дозу в обычное время.Не удваивайте дозу, чтобы наверстать упущенное.

Хранить при температуре 59–86 градусов F (15–30 градусов C) вдали от света и влаги. Не хранить в ванной. Храните все лекарства в недоступном для детей и домашних животных. Не смывайте лекарства в унитаз и не выливайте их в канализацию, если это не предписано. Правильно утилизируйте этот продукт, когда срок его годности истек или он больше не нужен. Проконсультируйтесь с фармацевтом или местной компанией по утилизации отходов, чтобы узнать, как безопасно утилизировать продукт.

Последняя редакция информации — июнь 2020 г.Авторские права (c) 2020 First Databank, Inc.

таблеток оксандролона

Что это за лекарство?

ОКСАНДРОЛОН (ox AN droe lone) — стероид. Это лекарство используется, чтобы помочь людям набрать вес. Он также используется для лечения боли в костях у пациентов с остеопорозом.

Это лекарство можно использовать для других целей; Если у вас есть вопросы, обратитесь к своему врачу или фармацевту.

ОБЩЕЕ НАИМЕНОВАНИЕ БРЕНДА: Oxandrin

Что мне следует сказать своему врачу, прежде чем я приму это лекарство?

Им необходимо знать, есть ли у вас какое-либо из этих условий:

  • рак груди
  • сахарный диабет
  • высокий уровень кальция в крови
  • Болезнь почек
  • Рак простаты, увеличение
  • необычная или аллергическая реакция на оксандролон, другие лекарства, пищевые продукты, красители или консерванты
  • беременна или пытается забеременеть
  • кормление грудью

Как мне использовать это лекарство?

Принимайте это лекарство внутрь, запивая стаканом воды.Следуйте инструкциям на этикетке с рецептом. Принимайте дозы через равные промежутки времени. Не принимай свои лекарства чаще, чем указано.

Проконсультируйтесь со своим педиатром по поводу использования этого лекарства у детей. Хотя этот препарат может быть назначен при определенных состояниях, меры предосторожности все же применяются.

Передозировка: Если вы считаете, что приняли слишком много этого лекарства, немедленно обратитесь в токсикологический центр или в отделение неотложной помощи.

ПРИМЕЧАНИЕ: Это лекарство предназначено только для вас. Не делись этим лекарством с другими.

Что делать, если я пропущу дозу?

Если вы пропустите прием, примите его как можно скорее. Если пришло время для следующей дозы, примите только эту дозу. Не принимайте двойные или дополнительные дозы.

Что может взаимодействовать с этим лекарством?

  • Лекарства от сахарного диабета
  • стероидные препараты, такие как преднизон или кортизон
  • варфарин

Этот список может не описывать все возможные взаимодействия. Дайте своему врачу список всех лекарств, трав, безрецептурных препаратов или пищевых добавок, которые вы используете.Также сообщите им, если вы курите, употребляете алкоголь или запрещенные наркотики. Некоторые предметы могут контактировать с вашим лекарством.

На что следует обращать внимание при использовании этого лекарства?

Посещайте врача для регулярных осмотров. Пока вы принимаете это лекарство, вам потребуется сделать важный анализ крови.

Не было доказано, что это лекарство улучшает спортивные способности.

Это лекарство может повлиять на уровень сахара в крови. Если у вас диабет, посоветуйтесь с врачом или медицинским работником, прежде чем менять диету или дозу лекарства от диабета.

Это лекарство запрещено использовать в США, Международных олимпийских комитетах и ​​других спортивных организациях.

Какие побочные эффекты я могу заметить при приеме этого лекарства?

Побочные эффекты, о которых вы должны как можно скорее сообщить своему врачу или медицинскому работнику:

  • аллергические реакции, такие как кожная сыпь, зуд или крапивница, отек лица, губ или языка
  • увеличение груди
  • проблемы с дыханием
  • изменения настроения, особенно гнев, депрессия или ярость
  • темная моча
  • у женщин: угри, изменение месячного цикла, низкий голос, увеличение клитора, увеличение количества волос на лице
  • тошнота, рвота
  • Боль в правом верхнем углу живота
  • отек лодыжек
  • слишком частые или стойкие эрекции
  • Проблемы с мочеиспусканием
  • необычное кровотечение или синяк
  • пожелтение глаз или кожи

Побочные эффекты, которые обычно не требуют медицинской помощи (сообщите своему врачу или медицинскому работнику, если они продолжаются или вызывают беспокойство):

  • Угри у мужчин
  • изменение полового влечения или производительности
  • Выпадение волос
  • головная боль

Этот список может не описывать все возможные побочные эффекты. Спросите у своего доктора о побочных эффектах. Вы можете сообщить о побочных эффектах в FDA по телефону 1-800-FDA-1088.

Где мне хранить лекарство?

Хранить в недоступном для детей месте. Этим лекарством можно злоупотреблять. Храните лекарство в надежном месте, чтобы защитить его от кражи. Ни с кем не сообщайте это лекарство. Продажа или раздача этого лекарства опасна и противоречит закону.

Хранить при комнатной температуре от 15 до 30 градусов C (59 и 86 градусов F). Хранить контейнер плотно закрытым.После окончания срока годности, выбрасывайте все неиспользованные медикаменты.

ПРИМЕЧАНИЕ. Этот лист является сводным. Он может не покрывать всю возможную информацию. Если у вас есть вопросы об этом лекарстве, поговорите со своим врачом, фармацевтом или поставщиком медицинских услуг.

Оксандролон до после, оксандролон до после — Профиль — IPEME Fórum

Оксандролон до после, оксандролон до после — Купить анаболические стероиды в Интернете







Оксандролон до после
Лучшие сармы на рынке. Ниже приведены некоторые из лучших сармов, которые вы могли купить. Они не только отлично работают сами по себе, но и отлично сочетаются с другими сармами. Фактические результаты, которые вы можете получить от них, могут отличаться. Поэтому важно, чтобы вы подбирали сарм, отвечающий вашим требованиям. Компании, которые я рекомендую. Я купил сармы почти у каждой компании на рынке, которая осуществляет поставки в мою страну (австралию). Есть три компании, которые я считаю лучшими на рынке сармса. Я всегда получал хорошие результаты с их продуктом, с рекомендациями… sarms компании подробнее ».Андарин — один из лучших доступных на рынке сармов для похудения. Возрастает осознание последствий лишнего веса. Переориентация, которая усилила преимущества, которые дает здоровый вес для оптимального здоровья, в настоящее время растет число людей, ищущих здоровые способы похудения. Какие сармы лучше всего подходят для похудения и стрижки? Когда дело доходит до похудания, мы рекомендуем принимать lgd-4033 перорально. Даже если он не помогает избавиться от жира (как мы упоминали выше), он является одним из самых безопасных и простых в использовании сармов на рынке.Это также помогает избежать побочных эффектов, таких как облысение и прыщи. У большинства сармов есть исследовательские химические названия (rd140, yk11 и т. Д.), Потому что они еще не дебютировали на рынке, и им даже не было присвоено сокращенное химическое название. Тем не менее, несколько сармов прошли клинические испытания на людях, иногда на здоровых добровольцах, а иногда и на людях с заболеваниями. Как я уже говорил, я думаю, что рад 140, остарин и лигандрол — лучшие препараты на рынке. Люди часто объединяют yk-11 в эту группу, но технически это не сарм, поэтому я не упомянул об этом.Rad 140 — безусловно, самый сильный сарм на рынке с анаболическим соотношением 90: 1. Ни один другой сарм не сравнится по силе с тестолоном. Когда вы покупаете sarms онлайн, у вас есть довольно много вариантов. Лучшие продавцы оружия сейчас — это проверенные наукой пептиды. Био и секретные супы. Научная биография ранее была известна как irc. Bio, лидер американского рынка сармов. Их сармы известны своим высочайшим качеством. Лучшие сармы для силы. Поиск лучших сармов для бодибилдинга с точки зрения набора их для наращивания силы очень субъективен, поскольку все сармы либо сохраняют мышцы, либо наращивают их, либо повышают уровень энергии.Однако многие люди говорят, что классический стек силы — это lgd-433 и yk-11. У нас лучшие сармы Северной Америки. Мы предлагаем вам бутылку объемом 40 мл по той же цене. Этот бренд из США, ранее известный как irc. Био, возможно, является лидером отечественного рынка по чистому и качественному оружию. Бренд стремится к тому, чтобы их покупатели получали безопасные продукты с минимальными побочными эффектами, поэтому все их продукты проходят лабораторные испытания на предмет желаемого уровня чистоты до того, как будут утверждены для продажи.Где купить сармы — лучшие сармы на рынке Теперь настало время показать вам, где купить сармы, это места, где вы найдете лучшие сармы на рынке. Всего их четыре, и каждый магазин уникален. Вы поймете, о чем мы говорим, как только мы начнем их просматривать. Sarms — одна из лучших добавок для бодибилдинга на рынке, которая появилась на рынке в последние годы и начинает заменять стероиды, будучи наиболее популярными добавками, которые вы можете принимать.Это одна из причин, почему сармы стали такими популярными.
Длительное употребление оказывает пагубное воздействие, оксандролон до и после.
Оксандролон до после
Лазар до / после (см. Выше) является хорошим примером «трансформации анавара». Я не говорю, что лазар на 100% принимал анавар, но если вы усердно сидите на диете и много работаете … эти результаты типичны для тех, кто принимает анавар в течение 8 недель. Во время этой трансформации он не набрал много мышц, он только что потерял около 7% жира. Оксандролон (торговая марка: anavar) представляет собой 17-альфа-алкилированный (c17-aa) стероид, полученный из дигидротестостерона (dht).Впервые он был создан «Searle» в 1964 году в качестве терапевтического средства для лечения истощения мышц у неизлечимо больных мужчин. Однако именно во время эпидемии ВИЧ-инфекции в 1980-х этот препарат получил широкое распространение. — цикл анавар является домом для обзоров, результатов и фотографий до и после бодибилдеров и женщин, которые использовали таблетки анавара. Где купить этот стероид и каковы лучшие дозировки? Оксандролон для сжигания жира. Ученые из университета южной калифорнии провели эксперимент, который продемонстрировал, что удаленная жировая ткань не возвращается сразу после отмены этого стероида.Исследование спонсировалось правительством США и производителем оксандролона — Savient. Анавар (оксандролон) — популярный пероральный анаболический стероид. Несмотря на то, что он мягкий и считается многими бодибилдерами слабый стероид, в фитнес-сообществе он совершенно неверно понимается. В этой статье я покажу вам, как лучше всего использовать это соединение для достижения максимальных результатов. Анавар до и после фото альтернативы анварол (таблетки анварола) результаты: она хочет сократить жировые отложения, увеличить мышечную массу и подтянуть свое тело, чтобы выглядеть стройнее и сексуальнее. Затем Шина перешла на курс только анварола в течение 6 недель, чтобы достичь этой потрясающей женской милой формы тела. Фотографии и видео Anavar до и после лечения рисуют убедительную картину того, как работает этот стероид. Без сомнения, анавар / оксандролон может помочь вам улучшить тело за счет наращивания сухой мышечной массы, силы и сжигания жира. Вот почему мы рекомендуем принимать добавки с расторопшей до, во время и после цикла анавара. Что касается либидо, если вы сексуально активны. Это может стать проблемой, а также обострить отношения, если вы не будете осторожны.Поэтому стоит рассмотреть эти аспекты перед тем, как начать цикл. Улучшение метаболизма белка у субъектов с оксандролоном сопровождалось повышенной эффективностью синтеза белка, определяемой процентом внутриклеточных аминокислот, направленным на синтез белка (17 ± 6% до, 37 ± 5% после оксандролона; p = 0. Распад мышечного белка не изменился. Ваши месячные должны вернуться в норму после того, как вы перестанете употреблять варку. Однако иногда могут пройти месяцы, прежде чем ваш кровоток вернется к уровню до начала цикла.Жирная кожа — начиная со 2 недели. Если вы склонны к жирной коже и акне, оксандролон наверняка может вызвать некоторые высыпания. Это может произойти на вашей спине или на вашем лице. Если вы раньше принимали винстрол, вы можете увеличить его до 10 мг в день. Но, как мы уже упоминали, эта доза, скорее всего, вызовет побочные эффекты, без которых может обойтись любая женщина-спортсменка. Результаты винстрола: чего ожидать. Когда Бен Джонсон принял станозолол, он смог сокрушить своих конкурентов и надежды США на олимпийскую победу. Анаболически-андрогенные стероиды (ААС) созданы синтетически и представляют собой поддельную версию мужского полового гормона, то есть оксандролона до и после.
Какие лучшие препараты на рынке, оксандролон до после
Оксандролон до после, цена купить легальные анаболические стероиды бодибилдинговые препараты. Например, чрезмерное употребление DHEA было связано с повышением уровня эстрогена (женского полового гормона), что может ухудшить работоспособность и привести к таким состояниям, как гинекомастия, оксандролон до и после. С более мощными легальными альтернативами стероидов вам следует придерживаться уровней дозировки, установленных научными исследованиями. Сообщалось, что пальметто, травяной экстракт, часто входящий в состав натуральных заменителей стероидов, разжижает кровь, что может привести к серьезным проблемам, если вы примете его перед операцией (9).Абсолютная атака с вертикальным стеком, окончательный вертикальный стек Заключение: вы должны знать, какая у вас кожа, что очень важно, чтобы искать лечение прыщей для ваших конкретных потребностей, оксандролон, до и после. Оксандролон до после, цена лучших стероидов для бодибилдинга. Обычно уровень тестостерона возвращается к норме в течение 1-4 месяцев; однако ПКТ значительно сократит этот процесс, оксандролон до и после.
https://vertebra.info/community/profile/sarms45823869/
Кардарин — одна из самых популярных добавок для бодибилдинга на рынке.Хотя почти все добавки дают аналогичные обещания — набрать больше мышц, сжечь жир, получить заряд энергии для силовых тренировок — кардарин выделяется тем, что он также может защитить сердце и снизить уровень плохого холестерина. В заключение, эти три компании являются лучшими поставщиками оружия на рынке прямо сейчас, с чистыми продуктами, отличными ценами и быстрой доставкой. Наука био — наш любимый источник оружия из всего этого списка, благодаря общему качеству компании, конкурентоспособным ценам и поддержке клиентов. Какие самые лучшие поставщики оружия в США? В этой статье мы хотим рассказать вам о лучших поставщиках оружия в США, чтобы вам не приходилось тратить время на покупку некачественной продукции.Мы расскажем о трех основных поставщиках сармов в США: проверенные пептиды и наука. Био и секретные супы. Лучший способ сложить sarms — это попробовать один из заранее определенных наборов, которые я создал в этой статье. Просто купите рекомендованные sarms онлайн и принимайте их в одно и то же время каждый день, в течение 8-недельного или 12-недельного цикла, а затем п.п. Какой самый лучший стек sarms? для увеличения объема лучшим набором sarm будет лигандрол, yk-11 и mk-677. Тройной стек sarms также известен как лучший стек sarms для резки. Его часто используют во время фазы сушки, потому что вы рискуете потерять мышцы, потребляя меньше калорий. Что ж, позвольте мне сказать вам … тройной стек sarms очень эффективен для сохранения мышц, наращивания мышц и сжигания жира. Выбор лучшего продукта sarm для вас будет зависеть от вашей цели, хотите ли вы нарастить мышцы или похудеть. Эффект от добавок sarm будет более выраженным, если вы сочетаете их со строгим фитнес-режимом и здоровым питанием. Использование sarms поможет вам достичь идеального размера быстрее, чем любой другой фитнес-продукт на рынке.Три лучших препарата на рынке всего несколько лет назад, стероиды правили небесами в сфере повышения производительности, будь то в спорте, бодибилдинге или других областях фитнеса. Однако вскоре этот парень с плаката заработал себе дурную репутацию. Лучший сарм на рынке остарин (также известный как MK-2866) — это самый популярный сарм, который был очень долгое время, потому что это первый сарм, который заставил людей серьезно улучшить свое телосложение и спортивные результаты. У большинства sarms есть исследовательские химические названия (rd140, yk11 и т. Д.), потому что они еще не дебютировали на рынке и даже не получили сокращенное химическое название. Тем не менее, несколько сармов прошли клинические испытания на людях, иногда на здоровых добровольцах, а иногда и на людях с заболеваниями. В этом обзоре мы подробно рассмотрим некоторые из лучших сармов и лучшие стеки сармов на рынке сегодня. Лигандрол (lgd-4033), если вы хотите похудеть, lgd-4033 лигандрол является идеальным средством для использования. Эта добавка, созданная на основе лигандных фармацевтических препаратов, эффективно сжигает калории во время тренировок.Из всех доступных на рынке препаратов он остается самым популярным вариантом для набора качественной мышечной массы. Он резко увеличивает синтез белка, запасы гликогена и кровоток. Вы испытаете большую накачку, более длительные тренировки и более быстрое время восстановления. Лучше всего то, что lgd 4033 — один из самых недорогих сармов на рынке. Этот бренд из США, ранее известный как irc. Био, возможно, является лидером отечественного рынка по чистому и качественному оружию. Бренд стремится к тому, чтобы их покупатели получали безопасные продукты с минимальными побочными эффектами, поэтому все их сармы проходят лабораторные испытания на желаемый уровень чистоты перед тем, как быть одобренными для продажи.
Одним из преимуществ натуральных альтернатив стероидов является то, что они не похоже, имеют тот же профиль побочных эффектов, что и настоящие стероиды, что является лучшим препаратом на рынке.Тем не менее, поскольку эти соединения действительно изменяют химический состав гормонов, существует риск побочных эффектов при использовании некоторых натуральных стероидных альтернатив. Например, чрезмерное употребление ДГЭА связано с повышением уровня эстрогена (женского полового гормона), что может ухудшить работоспособность и привести к таким состояниям, как гинекомастия. http://wordpress.ndrc-apps.fr/community/profile/sarms24522810/ Приготовьтесь стать большим, экономя при этом свои органы и сэкономив при этом серьезные деньги. Анаболические стероиды бывают разных форм; в то время как инъекционные версии являются наиболее распространенными, стероидные таблетки составляют большую часть поля, оксандролон до и после.Фактически, существует множество добавок, которые были созданы, имитируя мощные преимущества анаболических стероидов, но без неприятных побочных эффектов. Давайте взглянем на 10 лучших стероидных альтернатив, разбитых на наращивание мышечной массы и сжигание жира, оксандролон до и после. Они часто являются необходимой частью детоксикации для людей, которые много месяцев или лет употребляли алкоголь, оксандролон до и после. Бензодиазепины активируют нейромедиатор под названием ГАМК (гамма-аминомасляная кислота), предотвращая судороги, которые могут возникнуть как фатальные осложнения при отмене алкоголя.Настоящие стероиды нацелены на процесс наращивания мышечной массы вашего тела, напрямую обеспечивая большее количество стероидов и гормонов, которые наращивают мышцы. С другой стороны, природные стероидные альтернативы делают это косвенно: они обеспечивают строительные блоки, которые ваше тело использует для синтеза стероидов и гормонов, или они усиливают биологические процессы, которые повышают эффективность естественных стероидов, которые ваше тело уже производит, оксандролона до и после. Вот некоторые из наиболее распространенных препаратов ПКТ, которые люди используют для послекурсовой терапии: Кломид ПКТ: 50 мг / день в течение 3 недель (или 100 мг / день в первые 10 дней, затем 50 мг / день в течение еще 10 дней). Нолвадекс ПКТ: 40 мг / день. день 1-2 неделя и 20 мг / день 3-4 неделя.Сделать ПКТ важной частью каждого стероидного цикла — это привычка, которую вам нужно будет выработать, начиная с самого первого курса в качестве новичка, оксандролон до и после. КАК ЭТО ДОЗИРУЕТСЯ: от 20 до 40 мкг (мкг) в день. ЧТО ГОВОРЯТ КУЛЬТУРЫ: Стероид для инъекций, появившийся еще в 70-х, обычно принимаемый вместе с тестостероном, оксандролоном до и после. Андрогенный относится к повышенным мужским характеристикам, оксандролон до и после. Но даже ученые сокращают его до анаболических стероидов. Вот в основном то, что они из себя представляют и как они функционируют, оксандролон до и после.Они используются для лечения респираторных заболеваний и состояний, таких как астма. Подпишитесь на информационный бюллетень по вопросам здоровья MedicineNet, оксандролон до и после. Нажимая «Отправить», я соглашаюсь с Условиями и положениями и Политикой конфиденциальности MedicineNet и понимаю, что могу отказаться от подписок MedicineNet в любое время. Есть так много исследований, указывающих на то, что для любого силового спортсмена нетрудно использовать оксандролон до и после. Креатин работает на основе простой идеи: активно перерабатывать энергию в мышцах.Оксандролон до после, оксандролон до после. Когда-либо задавался вопросом, как эти тяжелые штангисты стали такими большими, оксандролон до и после. В то время как некоторые, возможно, получили свои мышцы благодаря строгому режиму тяжелой атлетики и диеты, другие, возможно, получили это благодаря незаконному использованию стероидов. Стероиды — это синтетические вещества, похожие на мужской половой гормон тестостерон. https://1.advicehome.com/community/profile/sarms15835600/ Для достижения наилучшего результата цикл оксандролона необходимо выполнять в течение двух-четырех недель.Тем не менее, рекомендуется проконсультироваться с врачом, чтобы избежать побочных эффектов цикла анавара перед употреблением любого продукта оксандролона, поскольку чрезмерное или неправильное измерение всего, что вы принимаете, может привести к проблеме. Таблетки оксандролона можно принимать как во время еды, так и после. Из цикла никто не отменяет спортивное питание, диеты и тренировки. Итак, как видите, оксандролон — лучший легкий стероид для женщин. И с этим не поспоришь. Эффект от приема анавара поразит даже самого требовательного потребителя фармацевтических препаратов.Анавар (оксандролон) — один из самых мягких, но безопасных анаболических стероидов всех времен. В качестве такого мягкого натурального стероида это один из немногих, который очень хорошо переносится большинством женщин, настолько, что во многих кругах его просто называют «женским стероидом». Оксандролон (очень часто известный под своим торговым наименованием — анавар) является чрезвычайно популярным анаболическим стероидом, несмотря на то, что хорошо известно, что он не является одним из самых сильных анаболических стероидов, к тому же он является одним из самых дружелюбных, когда дело касается. к побочным эффектам.Улучшение белкового метаболизма у субъектов с оксандролоном сопровождалось повышенной эффективностью синтеза белка, определяемой процентом внутриклеточных аминокислот, направленным на синтез белка (17 ± 6% до, 37 ± 5% после оксандролона; p = 0. Распад мышечного белка не изменился. . Дозировка оксандролона, которую вы используете, будет зависеть от множества различных факторов, включая ваши цели и другие составляющие, с которыми вы можете его комбинировать. Прежде чем рассматривать вопрос об использовании этого стероида, прочтите рекомендации по дозировке оксандролона (медицинские или бодибилдинг), чего вы можете ожидать Что касается результатов, побочных эффектов и общей безопасности.Приходите в универсальный магазин, чтобы нарастить хардкорные мышцы! это, вероятно, наиболее часто задаваемый вопрос об анаваре (оксандрол. Оксандролон следует использовать с осторожностью, если вообще следует использовать у пациентов с уже существующим заболеванием печени или холестазом. Андрогенно-анаболические стероиды были связаны с развитием определенных типов заболеваний печени, включая peliosis hepatis (заполненные кровью кисты в печени и иногда в тканях селезенки), доброкачественные и злокачественные опухоли печени (например, Анавар до и после фото и видео рисуют убедительную картину того, как работает этот стероид. Без сомнения, анавар / оксандролон может помочь вам улучшить тело за счет наращивания сухой мышечной массы, силы и сжигания жира. Анавар перед операцией разрешил вопрос: привет, врач прописал пероральный анавар 20 мг в день в течение 6 недель, чтобы восстановить меня (потерял много веса) после серьезной травмы спины, я забыл упомянуть, что на данный момент у меня мастоидит (в связи с операцией конец июля) я могу продолжать принимать их? Анавар до и после фото альтернативы анварол (таблетки анварола) результаты: она хочет сократить жировые отложения, увеличить мышечную массу и подтянуть свое тело, чтобы выглядеть стройнее и сексуальнее.Затем Шина перешла на курс только анварола в течение 6 недель, чтобы достичь этой потрясающей женской милой формы тела. Вот почему мы рекомендуем принимать добавки с расторопшей до, во время и после цикла анавара. Что касается либидо, если вы сексуально активны. Это может стать проблемой, а также обострить отношения, если вы не будете осторожны. Таким образом, перед началом цикла стоит учесть эти аспекты. Самые популярные продукты:
Maha Pharma
Тестостерона ацетат и энантат 250 мг / мл x 10 мл
1-Test Cyp 200
Androx 400 мг / мл x 10 ампер
Оксиметолон 50 мг (50 таблеток)
Винстрол — 50 мг
Dragon Pharma США DOM до 20 дней
Галобол 5 мг (50 таблеток)
Bayer
Test Propionate 70mg
Testosterone Enanthate 100mg
Test Enanthate 250
Tren Acetate 100mg Dianabol 50183 Tren Acetate 100mg Dianabol 50183 Провирон 25 мг (50 таблеток)
ANAVAR 10 мг (100 таблеток)
MSD
Oxa-Max 10 мг (100 таблеток)
Virigen Testocaps 40 мг (30 капсул)
Gen-Shi Laboratories

Быстрая доставка: Нью-Йорк, Лос-Анджелес, Чикаго, Хьюстон, Феникс, Филадельфия, Сан-Антонио, Сан-Диего, Даллас, Детройт, Сан-Хосе, Индианаполис, Джексонвиль, Сан-Франциско, Хемпстед, Колумбус, Остин, Мемфис, Балтимор, Шарлотта, Форт-Уэрт, Милуоки, Бостон, Эль-Пасо, Вашингтон, Нэшвилл-Дэвидсон, Сиэтл, Денвер, Лас-Вегас, Портленд, Оклахома-Сити, Тусон, Альбукерке, Атланта, Лонг-Бич, Брукхейвен, Фресно, Новый Орлеан, Сакраменто, Кливленд, Меса, Канзас-Сити, Вирджиния-Бич, Омаха, Окленд, Майами, Талса, Гонолулу, Миннеаполис, Колорадо-Спрингс. Аризона, Калифорния, Колорадо, Округ Колумбия, Флорида, Джорджия, Гавайи, Иллинойс, Индиана, Луизиана, Мэриленд, Массачусетс, Мичиган, Миннесота, Миссури, Небраска, Невада, Нью-Мексико, Нью-Йорк, Северная Каролина, Огайо, Оклахома, Орегон, Пенсильвания, Теннесси, Техас, Вирджиния, Вашингтон, Висконсин, Алабама, Алабама, Аляска, AK, Аризона, Аризона, Арканзас, АР, Калифорния, Калифорния, Колорадо, Колорадо, Коннектикут, Коннектикут, Делавэр, Делавэр, Делавэр, Округ Колумбия, Округ Колумбия, Флорида, Флорида, Джорджия, Джорджия, Гавайи, Гавайи, Айдахо, Айдахо, Иллинойс, Иллинойс, Индиана, Индиана, Айова, Айова, Канзас, Канзас, Кентукки, Кентукки, Луизиана, Лос-Анджелес, Мэн, Мэн, Мэриленд, Мэриленд, Массачусетс, Массачусетс, Мичиган, Мичиган, Миннесота, Миннесота, Миссисипи, Миссисипи, Миссури, Миссури, Монтана, MT, Небраска, NE, Невада, Невада, Невада, Нью-Гэмпшир, NH, Нью-Джерси, Нью-Джерси, Нью-Мексико, Нью-Мексико, Нью-Йорк, Нью-Йорк, Северная Каролина, Северная Каролина, Северная Дакота, Северная Дакота, Огайо, Огайо, Оклахома, Оклахома, Орегон, ИЛИ, Пенсильвания, Пенсильвания, Род-Айленд, Род-Айленд, Южная Каролина, Южная Каролина, Южная Дакота, Южная Дакота, Теннесси, Теннесси, Теннесси, Техас, Техас, Юта , Юта, Вермонт, Вирджиния, Вирджиния, Вашингтон, WA, Западная Вирджиния, WV, Висконсин, WI, Вайоминг, WY

Доставка по всему миру: США, Италия, Великобритания, Германия, Австралия, Испания, Франция, Нидерланды, Ирландия, Швейцария, Япония, Дания, Швеция, Австрия, Норвегия, Новая Зеландия, Греция, Бельгия blabla

Кратковременное введение оксандролона стимулирует синтез чистого мышечного белка у молодых мужчин1 | Журнал клинической эндокринологии и метаболизма

Кратковременный прием тестостерона стимулирует чистый синтез белка у здоровых мужчин. Мы исследовали, улучшит ли оксандролон [оксандрин (OX)], синтетический аналог тестостерона, чистый синтез мышечного белка и транспорт аминокислот через ногу. Шесть здоровых мужчин [22 ± 1 (± se) год] были исследованы в постабсорбционном состоянии до и после 5 дней перорального приема ОХ (15 мг / день). Синтез и распад мышечного белка определяли с помощью трехкомпонентной модели с использованием стабильных изотопных данных, полученных при отборе проб бедренной артерио-венозной крови и биопсии мышц. Для определения скоростей фракционного синтеза мышечного белка использовали метод «предшественник-продукт».Также были непосредственно рассчитаны коэффициенты фракционной разбивки. Общая концентрация рибонуклеиновой кислоты (мРНК) инсулиноподобного фактора роста I в скелетных мышцах и рецептора андрогенов (AR) определялась с помощью ОТ-ПЦР. Синтез мышечного белка на основе модели увеличился с 53,5 ± 3 до 68,3 ± 5 (среднее ± стандартное отклонение) нмоль / мин · 100 мл / ногу ( P <0,05), тогда как распад белка не изменился. Входящий транспорт аминокислот оставался неизменным с ОХ, тогда как исходящий транспорт уменьшался ( P <0.05). Скорость фракционного синтеза увеличилась на 44% ( P <0,05) после введения ОХ без изменения скорости фракционного распада. Таким образом, чистый баланс между синтезом и разрушением стал более положительным при использовании обеих методик ( P <0,05) и не отличался от нуля. Кроме того, ОТ-ПЦР показала, что введение ОХ значительно увеличивало концентрации мРНК AR скелетных мышц без изменения концентрации мРНК инсулиноподобного фактора роста I. Мы пришли к выводу, что кратковременное введение ОХ стимулировало увеличение синтеза белка в скелетных мышцах и улучшало внутриклеточное повторное использование аминокислот.Механизм этой стимуляции может быть связан с индуцированным OX увеличением экспрессии AR в скелетных мышцах.

СПОРТСМЕНОВ уже давно используют анаболические агенты для улучшения мышечной массы и силы. Однако клиницисты только недавно осознали преимущества анаболических агентов для пациентов с мышечным истощением, связанным с травмами или заболеваниями. Недавно несколько клинических исследований продемонстрировали положительные преимущества введения тестостерона (Т) для различных групп пациентов. В частности, мужчины с гипогонадизмом получают пользу от заместительной терапии Т за счет увеличения массы скелетных мышц (1–3), увеличения плотности костей (2) и увеличения синтеза белка (1).Аналогичным образом, у пожилых мужчин, получающих заместительную терапию Т, увеличилась безжировая масса тела (4), сила (5) и синтез белка (5) наряду со снижением резорбции костей (4). Более того, изменения в составе тела, включая потерю безжировой массы тела, сильно коррелируют с уровнями андрогенов у мужчин с гипогонадизмом с истощающей миопатией с синдромом приобретенного иммунодефицита (СПИД) (6).

Недавно мы показали, что энантат (ТЕ), вводимый внутримышечно здоровым молодым мужчинам, увеличивает чистый синтез белка и повторное использование внутриклеточных аминокислот в скелетных мышцах (7).Кроме того, несколько других исследований показали, что введение Т увеличивает синтез мышечного белка (1, 5, 8), хотя в этих исследованиях не удалось измерить распад белка. Одно из основных ограничений предыдущих исследований фракционной скорости синтеза (FSR) состоит в том, что невозможно одновременно оценить распад белка. Следовательно, традиционный подход к изучению кинетики мышечного белка (, т.е. FSR) не дал информации о чистом балансе между синтезом и распадом.Поэтому наша лаборатория разработала новый метод измерения фракционного распада белка, который не зависит от артериовенозной (A-V) модели (9).

Хотя природные андрогены, такие как T, явно стимулируют синтез мышечного белка, они также обладают андрогенным или вирилизирующим действием. Часто это ограничивает использование этих андрогенов врачом для определенных групп пациентов, таких как мужчины с гипогонадизмом. Тем не менее, были предприняты усилия по поиску альтернативных анаболических агентов, которые можно было бы использовать у женщин и детей, страдающих заболеваниями или травмами, приводящими к истощению мышц.Оксандролон [Oxandrin (OX) Bio-Technology General, Iselin, NJ], синтетический аналог T, представляет собой пероральный анаболический стероид, который в настоящее время используется в качестве дополнительной терапии для увеличения веса у пациентов после хирургических операций, хронических инфекций и тяжелых травм. ОКС улучшил прибавку в весе у пациентов с миопатией из-за СПИДа (10), а также у выздоравливающих ожоговых пациентов (ожоги 30–50% общей площади тела) (11). Кроме того, OX используется клиницистами для лечения детей с нарушениями роста, такими как синдром Тернера и конституциональная задержка роста и полового созревания (12, 13).Недавнее пилотное исследование мальчиков с мышечной дистрофией Дюшенна показало, что оксид оксида азота в дозе 0,1 мг / кг в день улучшал мышечную силу в течение 3-месячного периода (14). Учитывая, что OX вводится перорально, а не внутримышечно, как и TE, простота введения делает его привлекательным как для врачей, так и для пациентов. Кроме того, предполагается, что OX имеет гораздо больший анаболический потенциал, чем T, с меньшим количеством андрогенных эффектов. Однако никакие исследования не показали, способствует ли OX, как и TE, стимуляция синтеза белка в скелетных мышцах.

Таким образом, мы исследовали, улучшает ли OX, предполагаемый анаболический агент, синтез чистого мышечного протеина и транспорт аминокислот у молодых мужчин натощак. Настоящее исследование было разработано, чтобы имитировать 5-дневное исследование TE на здоровых мужчинах, о котором говорилось ранее (7). Мы стремились оценить краткосрочные (5-дневные) эффекты умеренной дозы (15 мг / день) OX на включение аминокислот в мышечные белки с использованием установленной кинетической модели белка (15, 16). Мы также исследовали влияние ОХ на концентрацию рибонуклеиновой кислоты (мРНК) инсулиноподобного фактора роста I (IGF-I) и рецепторов андрогенов (AR) в скелетных мышцах.

Объекты и методы

Субъекты

Шесть здоровых мужчин [возраст, 22 ± 3 (± стандартное отклонение) года; вес 77 ± 13 кг; рост 178 ± 7 см] изучались до и после приема суточной дозы перорального ОКС (15 мг / сут) в течение 5 дней. Все испытуемые дали информированное письменное согласие в соответствии с руководящими принципами, установленными наблюдательным советом медицинского отделения Техасского университета (Галвестон, Техас). Соответствие испытуемых оценивалось путем проведения медицинского обследования, которое включало электрокардиограмму, анализ крови, электролиты плазмы, концентрацию глюкозы в крови, а также тесты функции печени и почек.Субъекты с заболеваниями сердца или печени, нарушениями гипо- или гиперкоагуляции, сосудистыми заболеваниями, гипертонией, диабетом или аллергией на йодиды были исключены из участия.

Протокол эксперимента

Все исследования инфузии изотопов проводились в Центре общих клинических исследований Медицинского отделения Техасского университета. Субъекты были приняты за ночь перед каждым исследованием и не голодали с 22:00 до завершения исследования 5-часовой инфузии изотопов.Примерно в 06:30 на следующее утро (день 0) полиэтиленовый катетер 20 размера (Insyte-W, Becton Dickinson and Co., Sandy, UT) вставляли в антекубитальную вену одной руки для инфузии аминокислот. Второй полиэтиленовый катетер 20 калибра помещали в противоположное запястье для взятия крови для измерения системного индоцианинового зеленого (ICG). На руку и запястье помещали грелку для поддержания температуры около 65 ° C во время измерения кровотока.

В 07:00 в дни 0 и 5 были взяты исходные образцы крови для анализа фонового обогащения аминокислот, концентрации ICG и пиковых концентраций T и OX.Приготовленная непрерывная инфузия меченого фенилаланина была начата при следующей скорости инфузии (IR) и начальной дозе (PD): 1- [кольцо- 2 H 5 ] фенилаланин, IR = 0,05 мкмоль / кг · мин, PD = 2 мкмоль / кг. Приблизительно в 07:30 полиэтиленовый катетер Кука 3-Fr 8 см (Блумингтон, Индиана) под местной анестезией вводили в бедренную артерию и вену. Бедренные катетеры потребовались для взятия проб крови A-V и инфузии ICG (артерии) для определения кровотока в ногах.

Биопсию латеральной широкой мышцы бедра получали через 2 ч, 4 ч 30 мин и 5 ч инфузии индикатора с использованием 5-мм иглы Бергстрема, как описано ранее (16).Ткань немедленно замораживали в жидком азоте и хранили при -80 ° C до анализа. После 2-часовой биопсии была начата примированная (2 мкмоль / кг) непрерывная инфузия 1- [ 15 N] фенилаланина, которая поддерживалась до 4 часов (рис. 1). Артериальное и внутриклеточное обогащение l- [ 15 N] фенилаланином на плато и снова после распада было получено для целей определения скорости фракционного распада (FBR). Биопсии через 4 часа 30 минут и 5 часов были использованы для определения FBR. Фракционную скорость синтеза (FSR) белка скелетных мышц определяли путем включения 1- [кольцо- 2 H 5 ] фенилаланина в белок в течение 2–5 часов.

Рисунок 1.

Протокол инфузии стабильного изотопа. кольцо- 2 H 5 -PHE, 1- [кольцо- 2 H 5 ] фенилаланин; 15 N-ПГЭ, 1- [ 15 N] фенилаланин.

Рисунок 1.

Протокол инфузии стабильного изотопа. кольцо- 2 H 5 -PHE, 1- [кольцо- 2 H 5 ] фенилаланин; 15 N-ПГЭ, 1- [ 15 N] фенилаланин.

Образцы крови A-V были взяты с 20-минутными интервалами от 4 до 5 часов для определения кинетики аминокислот.За пятнадцать минут до часа отбора проб была начата непрерывная инфузия (IR = 0,5 мг / мин) ICG и позволена достичь системного равновесия (10-15 минут) для целей измерения кровотока в ногах. Последующий забор крови производился одновременно из бедренной вены и из нагретой вены запястья в течение часа отбора проб. Чтобы избежать нарушения измерений кровотока, все образцы крови A-V для определения аминокислотной кинетики были получены после измерения кровотока, и ICG была остановлена. ICG был перезапущен и позволил работать непрерывно в течение приблизительно 10-15 минут перед следующим измерением кровотока.

В конце 5-часового исследования инфузии субъектов кормили, и все периферические и бедренные катетеры были удалены. Начиная с 21:00 в день 0, все субъекты получали 15 мг OX (BTG Pharmaceuticals Co., Изелин, Нью-Джерси) перорально в течение 5 дней. На 3-й день субъекты вернулись в Центр общих клинических исследований в 07:00 для взятия пробы венозной крови для определения общих концентраций T и OX. На 5-й день описанный выше экспериментальный протокол был повторен.

Аналитические методы

Кровь. Концентрации немеченого и меченого фенилаланина определяли методом газовой хроматографии-масс-спектрометрии (ГХ-МС), как описано ранее (16). Вкратце, образцы крови A-V собирали в предварительно взвешенные пробирки, содержащие 15% сульфосалициловую кислоту. Добавляли известный внутренний стандарт (100 мкл / мл крови) и тщательно перемешивали. Состав этой стандартной смеси был 50,3 мкмоль / л 1- [кольцо- 13 C 6 ] фенилаланин. После повторного взвешивания пробирок для определения конечного объема крови пробирки центрифугировали, супернатант собирали и хранили при -20 ° C до анализа.Аминокислоты в крови были разделены с помощью катионообменной хроматографии (16) и обогащения внутреннего стандарта, а введенные индикаторы были определены на их производных трет--бутилдиметилсилил ( t -BDMS) (17). Используя ГХ-МС, изотопное обогащение свободных аминокислот в крови определяли с помощью положительной химической ионизации и мониторинга отдельных ионов (модель 5973, Hewlett-Packard Co., Пало-Альто, Калифорния). Наконец, кровоток в ногах определяли спектрофотометрически путем измерения сывороточной концентрации ICG при λ = 805 нм.

Мышца. Образцы мышц взвешивали, и белок осаждали 500 мкл 14% хлорной кислоты. Для измерения внутриклеточных концентраций фенилаланина добавляли раствор известного внутреннего стандарта (2 мкл / мг мышечной ткани). Раствор содержал 2,4 мкмоль / л 1- [кольцо- 13 C 6 ] фенилаланин. Супернатант собирали после гомогенизации ткани и центрифугирования. Эта процедура повторялась трижды. Объединенный супернатант с мышечными аминокислотами разделяли с помощью катионообменной хроматографии (16).Обогащение и концентрация внутриклеточных аминокислот определяли для их трет- -бутилметилсилильных производных (17) с помощью ГХ-МС в режиме электронного удара. Внутриклеточное обогащение определяли поправкой на внеклеточную жидкость на основе хлоридного метода (18). Оставшийся осадок промывали несколько раз 0,9% физиологическим раствором и снова абсолютным этанолом, сушили при 50 ° C в течение ночи и гидролизовали в 6 н. HCl при 110 ° C в течение 24 часов. Затем гидролизат пропускали через катионообменную колонку таким же образом, как обрабатывали кровь.Образцы анализировали на обогащение фенилаланином с помощью ГХ-МС (модель 8000, MD 800, Fisons Instruments, Манчестер, Великобритания) с использованием химической ионизации и стандартной кривой (19).

Гормональные анализы. Концентрацию общего Т измеряли в сыворотке с помощью коммерческого набора для РИА (Diagnostic Products, Лос-Анджелес, Калифорния). Свободный или биодоступный T измеряли с помощью равновесного диализа [Mayo Medical Laboratories (Рочестер, Миннесота), Quest Diagnostics, Inc., Nichols Institute (Сан-Хуан Капистрано, Калифорния)].Концентрации OX в сыворотке были измерены Олимпийской аналитической лабораторией Калифорнийского университета в Лос-Анджелесе. Вкратце, жидкостно-жидкостную экстракцию выполняли путем добавления 50 мкл внутреннего стандарта [16,16,17- 3 H] T (d 3 T; 12 мкг / мл; MSD Isotopes, Монреаль, Квебек), 1 мл 50% насыщенного буфера ацетата натрия (0,5 моль / л; pH 5,5) и этилового эфира (5 мл) на 0,5 мл плазмы. После встряхивания (10 мин) и центрифугирования (15 мин при 2000 об / мин) слой этилового эфира сушили в атмосфере азота при комнатной температуре и восстанавливали в 200 мкл метанола для анализа методом высокоэффективной жидкостной хроматографии.Жидкостную хроматографию выполняли на системе Shimadzu (Shimadzu, Columbia, MD), оснащенной колонкой Hypersil BDS C 18 , 50 × 2 мм (Keystone Scientific, Inc., Bellefonte, PA) и Hypersil BDS C 18 , Предколонка 20 × 2 мм, работающая при скорости потока 400 мкл / мин. Объем инъекции составлял 5 мкл. Градиент: метанол-вода (1: 1) в течение 1 мин, метанол-вода (9: 1) в течение следующей 1 мин, выдержка в течение 1 мин и возврат в исходное состояние через 0,5 мин. MS-анализы выполнялись на тройном квадруполе Perkin Elmer Corp.-Sciex API 300 (Norwalk, CT), оснащенный интерфейсом APCI. Температура небулайзера была оптимизирована для максимальной чувствительности при 350 ° C. Положительные ионы (m + 1) для OX (307,2; Searle Pharmaceutical, Чикаго, Иллинойс) и d 3 T (292,2) были введены во второй квадруполь для индуцированных столкновением. диссоциация. Ионы продукта 289,2 и 97,0 отслеживали и использовали для количественного определения OX и d 3 T соответственно. Концентрации определяли по шеститочечной калибровочной кривой.

Выделение тотальной РНК и качественная ОТ-ПЦР. Общую РНК выделяли из образцов биопсии мышц (50–75 мг) с использованием РНКзола B (Tel-Test, Inc., Friendswood, TX). Затем два микрограмма общей РНК были преобразованы в ДНК с использованием системы обратной транскрипции (Promega Corp., Мэдисон, Висконсин). Затем ДНК (5 мкл) подвергали ПЦР в присутствии соответствующих праймеров. Продукты ПЦР обрабатывали на геле Саузерна, и продукты амплифицированной ДНК определяли по размеру с помощью лестницы ДНК. Затем проводили саузерн-блоты и гибридизовали с олигонуклеотидами фрагмента ДНК.Глицеральдегидфосфатдегидрогеназа (GAP) коамплифицировалась в каждом образце в качестве внутреннего контроля. Для AR нижележащий праймер был включен в реакцию обратной транскриптазы. Праймеры и гибридизационные олигонуклеотиды для IGF-I и AR следующие: IGF-I: смысл, 5′-AAATCAGCAGTCTTGGAACC-3 ‘; антисмысловой, 5 ‘CTTCTGGGTCTTGGGCATGT 3′; олигонуклеотид, 5’-CAAGCCCACAG-GGTATGGCTCCAGCAGT-3 ‘; AR: смысл, 5’-GATGCTCTACTTCGCCCCTGA-3 ‘; антисмысловой, 5’-CCCAGCAAATAGAATTCCATGAC-3 ‘; олигонуклеотид, 5’-CTGGGTGTGGAAATAGATG-3 ‘; и GAP: смысл, 5’-GGTATCGTGGAAGGACTCAT-3 ‘; антисмысловой, 5’-TCCACCACCCTGT-TGCTGTA-3 ‘; олигонуклеотид, 5’-GTGGGTGTCGCTGTTGAAGT-3 ‘.

Плотность полос саузерн-блоттинга измеряли с помощью программы анализа ImageQuant (Molecular Dynamics, Inc., Саннивейл, Калифорния).

Расчеты

Кинетическая модель. Кинетика внутриклеточных свободных аминокислот была описана ранее (16). Тем не менее, мы кратко детализируем кинетические параметры, которые составляют трехпуловую модель кинетики аминокислот ноги (рис. 2).

Рисунок 2.

Трехкомпонентная модель кинетики аминокислот в ногах.Пулы свободных аминокислот в бедренной артерии (A), бедренной вене (V) и мышце (M) соединены стрелками , , что указывает на однонаправленный поток аминокислот между каждым отделением. Аминокислоты попадают в ногу через бедренную артерию (F в ) и выходят через бедренную вену (F из ). F V, A — это прямой поток из артерии в вену аминокислот, которые не попадают во внутриклеточную жидкость. F M, A и F V, M — это внутренний и внешний транспорт от артерии к мышце и от мышцы к вене соответственно.F M, O — вид внутриклеточной аминокислоты в результате протеолиза фенилаланина. F O, M — скорость исчезновения внутриклеточных аминокислот для синтеза белка фенилаланина.

Рисунок 2.

Трехкомпонентная модель кинетики аминокислот ноги. Пулы свободных аминокислот в бедренной артерии (A), бедренной вене (V) и мышце (M) соединены стрелками , , что указывает на однонаправленный поток аминокислот между каждым отделением. Аминокислоты попадают в ногу через бедренную артерию (F в ) и выходят через бедренную вену (F из ).F V, A — это прямой поток из артерии в вену аминокислот, которые не попадают во внутриклеточную жидкость. F M, A и F V, M — это внутренний и внешний транспорт от артерии к мышце и от мышцы к вене соответственно. F M, O — вид внутриклеточной аминокислоты в результате протеолиза фенилаланина. F O, M — скорость исчезновения внутриклеточных аминокислот для синтеза белка фенилаланина.

Бедренная артерия доставляет (F из ) аминокислоты в ногу, тогда как аминокислоты уходят через бедренную вену (F из ).Следовательно, эти аминокислоты могут перемещаться между отделами между артерией (A), веной (V) и мышцей (M). Внутренний транспорт аминокислот от A к M (F M, A ) и внешний транспорт аминокислот от M к V (F V, M ) происходит через бедренную артерию и вену соответственно. Таким образом, внутренний (F в ) и внешний (F из ) транспорт ткани был рассчитан следующим образом:

| \ mathrm {F} _ {\ mathrm {in}} {=} \ mathrm {C} _ {\ mathrm {A}} {\ times} \ mathrm {BF} $ |

| \ mathrm {F} _ {\ mathrm {out}} {=} \ mathrm {C} _ {\ mathrm {V}} {\ times} \ mathrm {BF} $ |

| \ mathrm {F} _ {\ mathrm {M, A}} {=} {\ {} {[} (\ mathrm {E} _ {\ mathrm {M}} {-} \ mathrm {E} _ {\ mathrm {V}} \ mathrm {) / (E} _ {\ mathrm {A}} {-} \ mathrm {E} _ {\ mathrm {M}}) {]} {\ times} \ mathrm {C} _ {\ mathrm {V}} {+} \ mathrm {C} _ {\ mathrm {A}} {\}} {\ times} \ mathrm {BF} $ |

| \ mathrm {F} _ {\ mathrm {V, M}} {=} {\ {} {[} (\ mathrm {E} _ {\ mathrm {M}} {-} \ mathrm {E} _ {\ mathrm {V}} \ mathrm {) / (E} _ {\ mathrm {A}} {-} \ mathrm {E} _ {\ mathrm {M}}) {]} {\ times} \ mathrm {C} _ {\ mathrm {V}} {+} \ mathrm {C} _ {\ mathrm {V}} {\}} {\ times} \ mathrm {BF} $ |

, где C A и C V и E A и E V — концентрации аминокислот и обогащение индикаторов в бедренной артерии и вене, а E M — это обогащение в мышцах. Кровоток в ноге представлен BF. Аминокислоты, которые обходят мышцу через бедренную артерию, можно вычислить с помощью любого из следующих выражений:

| \ mathrm {F} _ {\ mathrm {V, A}} {=} \ mathrm {F} _ {\ mathrm { in}} {-} \ mathrm {F} _ {\ mathrm {M, A}} $ |

| \ mathrm {F} _ {\ mathrm {V, A}} {=} \ mathrm {F} _ {\ mathrm {out}} {-} \ mathrm {F} _ {\ mathrm {V, M }} $ |

Модель также позволяет рассчитать скорость внутриклеточного появления (F M, O ) аминокислот в результате распада белка и скорость использования аминокислот (F O, M ) для синтеза белка.Внешний вид и утилизация аминокислот рассчитываются соответственно по следующим формулам:

| \ mathrm {F} _ {\ mathrm {M, O}} {=} \ mathrm {F} _ {\ mathrm {M, A}} { \ times} (\ mathrm {E} _ {\ mathrm {A}} \ mathrm {/ E} _ {\ mathrm {M}} {-} 1) $ |

| \ mathrm {F} _ {\ mathrm {O, M}} {=} (\ mathrm {C} _ {\ mathrm {A}} {\ times} \ mathrm {E} _ {\ mathrm {A }} {-} \ mathrm {C} _ {\ mathrm {V}} {\ times} \ mathrm {E} _ {\ mathrm {V}}) {\ times} \ mathrm {BF / E} _ {\ mathrm {M}} $ |

Следующее выражение представляет собой общую скорость появления (Ra M ) внутриклеточных аминокислот, которая является функцией распада белка (F M, O ) и транспорта внутрь ткани (F M, A ).

| \ mathrm {Ra} _ {\ mathrm {M}} {=} \ mathrm {F} _ {\ mathrm {M, O}} {+} \ mathrm {F} _ {\ mathrm {M, A} } $ |

Эффективность синтеза белка (PSE). Используя фенилаланин, мы рассчитали относительную эффективность синтеза белка следующим образом:

| \ mathrm {PSE} {=} \ mathrm {F} _ {\ mathrm {O, M}} \ mathrm {/ (F} _ {\ mathrm {M, A}} {+} \ mathrm {F} _ {\ mathrm {M, O}} \ mathrm {)} $ |

PSE определяется как доля скорости появления внутриклеточных аминокислот, которая включается в мышечные белки, с учетом того, что фенилаланин не окисляется в мышцах.Следовательно, F O, M представляет собой количество аминокислоты, включенной в мышечные белки. FSR. Используя традиционный метод «предшественник-продукт», мы определили FSR мышечных белков путем измерения скорости включения фенилаланинового индикатора в белок и обогащения внутриклеточного пула в качестве предшественника

| \ mathrm {FSR} {=} {[} ( \ mathrm {E} _ {\ mathrm {p2}} {-} \ mathrm {E} _ {\ mathrm {p1}} \ mathrm {) / (E} _ {\ mathrm {M}} {\ times} т ) {]} {\ times} 60 {\ times} 100 $ |

, где E p1 и E p2 представляют собой обогащения связанного с белком l- [ кольцо 2 H 5 ] фенилаланина в точках отбора проб через 2 и 5 часов. Среднее внутриклеточное обогащение l- [кольцо- 2 H 5 ] фенилаланином составляет E M , тогда как время в минутах представлено как t . Чтобы выразить FSR в процентах в час, выражение затем умножается на коэффициенты 60 (минут в час) и 100 соответственно.

FBR. Мы кратко обсудим новый метод измерения фракционного распада белка, который был разработан и подробно описан ранее (9). Кроме того, метод FBR был недавно подтвержден в отчете этой лаборатории (20).В этом методе используется вариант традиционного метода исходных продуктов для определения FSR. В этом случае продуктом являются свободные внутриклеточные аминокислоты, а предшественниками — артериальная кровь и тканевый белок.

Метод FBR включает остановку обогащения после достижения изотопного равновесия 1- [ 15 N] фенилаланина и определение скорости распада внутриклеточного обогащения аминокислот. Скорость распада свободного внутриклеточного обогащения определяется артериальным распадом (который продолжает обеспечивать определенное количество метки для внутриклеточного пула, а также немеченых аминокислот) и FBR (который обеспечивает остальные немеченые аминокислоты) . {\ mathrm {t} _ {\ mathrm {2}}}} \ mathrm {E} _ {\ mathrm {F}} (t) dt} {\ times} \ \ frac {\ mathrm {T}} {\ mathrm {Q} _ {\ mathrm {F}}} $ |

, где P = E F / (E A — E F ) на изотопном плато, E A (t) и E F (t) — артериальное и внутриклеточное обогащение, а T / Q F — отношение связанной и несвязанной аминокислоты в образце ткани.

Без переменных P и T / Q F в приведенном выше уравнении уравнение представляет собой просто традиционное уравнение прекурсор-продукт.Традиционное уравнение прекурсор-продукт предполагает, что продукт получен только из одного прекурсора. Однако при определении FBR продукт имеет два источника: аминокислоты плазмы и аминокислоты, связанные с белками. Таким образом, эти два источника представлены переменной P. P равно отношению распада белка к переносу аминокислот в клетку и рассчитывается путем определения разбавления обогащения аминокислот между плазмой и внутриклеточным пространством в изотопном устойчивом состоянии.

Фактор T / Q F необходим для того, чтобы сделать единицы FBR сопоставимыми с единицами FSR, так что единицы FBR представляют собой скорость распада белка, деленную на размер пула связанных аминокислот. Традиционное уравнение прекурсор-продукт вычисляет скорость превращения прекурсора в продукт, деленную на размер пула продуктов. Однако в случае FBR скорость распада белка делится на размер пула свободных внутриклеточных аминокислот. Наконец, в этой модели FBR, а также при кинетическом определении скорости появления в результате распада белка (F M, O ) и исчезновения в результате синтеза белка (F O, M ) необходимо сделать предположение, что метка не возвращается из распада белка обратно в свободный внутриклеточный пул.Это разумно, учитывая низкое обогащение мышечного пула по сравнению со свободным внутриклеточным обогащением при изотопном равновесии. В результате артериальная кровь остается единственным источником индикатора для свободного внутриклеточного пула. Напротив, немеченые аминокислоты как из артериальной крови, так и из распада белков вносят вклад в свободный внутриклеточный пул.

Статистический анализ. Сравнение основных условий и условий лечения проводилось с использованием парных тестов t .Статистическая значимость была установлена ​​при P ≤ 0,05. Данные представлены как среднее ± стандартная ошибка.

Результаты

Как показано в Таблице 1, стабильное состояние артерии было достигнуто в течение часа отбора проб (240–300 мин) как в контрольный период, так и после 5 дней введения ОХ. Однако обогащение артерий было значительно выше после лечения ОХ (таблица 1; P <0,05). Из-за несоблюдения приема лекарств одним субъектом все представленные данные включают только результаты пяти субъектов.

Таблица 1.

Обогащение свободных аминокислот бедренной артерии

Мин вливания . фенилаланин .
Контроль (трассирующий / трассируемый) . Оксандролон (индикатор / след) .
240 0,0646 ± 0,0035 0,0759 ± 0,0032 a
260 0.0640 ± 0,0030 0,0722 ± 0,0016 a
280 0,0647 ± 0,0038 0,0672 ± 0,0025 a
300 0,0638 ± 0,0017 0,05 9026 0,0638 ± 0,0017 905 905
Мин. Инфузия . фенилаланин .
Контроль (трассирующий / трассируемый) . Оксандролон (индикатор / след) .
240 0,0646 ± 0,0035 0,0759 ± 0,0032 a
300 0,0638 ± 0,0017 0,0715 ± 0,0022 a
Таблица 1.

Обогащение аминокислот бедренной артерии

Мин. Инфузия .
фенилаланин .
Контроль (трассирующий / трассируемый) . Оксандролон (индикатор / след) .
240 0,0646 ± 0,0035 0,0759 ± 0,0032 а
260 0,0640 ± 0,0030 0,0722 ± 0,0016 47 905 905 905 0,0048 905 048 905 048 048 0,0672 ± 0,0025 a
300 0.0638 ± 0,0017 0,0715 ± 0,0022 a
Мин. Инфузия . фенилаланин .
Контроль (трассирующий / трассируемый) . Оксандролон (индикатор / след) .
240 0,0646 ± 0,0035 0,0759 ± 0,0032 a
260 0,0640 ± 0.0030 0,0722 ± 0,0016 a
280 0,0647 ± 0,0038 0,0672 ± 0,0025 a
300 0,0638 ± 0,0017 0,0638 ± 0,0017 Концентрации OX в сыворотке на 3-й день (1,9 ± 0,4 нг / дл) и 5-й день (2,2 ± 0,3 нг / дл) введения OX, измеренные через 10 часов после перорального приема каждой вечерней дозы (2100 часов), оставались стабильными. Однако через 18 часов после лечения на 5-й день уровни OX в сыворотке крови заметно снизились (0.48 ± 0,06 нг / дл; P <0,01) по сравнению с 10-часовыми значениями дня 3 или 5. Общие сывороточные концентрации Т были в пределах нормального физиологического диапазона в день 0 (449 ± 35 нг / дл) и день 3 (441 ± 44 нг / дл) лечения ОХ. Однако к 5 дню общие сывороточные концентрации Т были значительно снижены (282 ± 45 нг / дл; P <0,05) ниже значений дня 0 и дня 3 (рис. 3). Концентрации свободного Т в сыворотке крови были в пределах нормального физиологического диапазона в дни 0, 3 и 5. Однако к 5 дню концентрации свободного Т в сыворотке были значительно снижены (98 ± 10 пг / мл; P <0.001) ниже значений дня 0 (121 ± 12 пг / мл) и дня 3 (126 ± 9 пг / мл). Следовательно, общая концентрация андрогенов (T + OX) снижалась параллельно со снижением T (рис. 3).

Рисунок 3.

Общая концентрация андрогенов. Общие сывороточные концентрации Т ( заштрихованная часть ) и OX ( черная часть ) у пяти молодых людей в дни 0, 3 и 5 *, T значительно снизился с дней 0 и 3 по 5 день ( P <0,05 ).

Рисунок 3.

Общая концентрация андрогенов. Общие сывороточные концентрации Т ( заштрихованная часть ) и OX ( черная часть ) у пяти молодых людей в дни 0, 3 и 5 *, T значительно снизился с дней 0 и 3 по 5 день ( P <0,05 ).

FSR увеличился с 0,057 ± 0,004% до 0,082 ± 0,008% / ч после 5 дней введения OX (рис.4; P <0,05), тогда как FBR остался неизменным (0,138 ± 0,005% против 0,118 ± 0,0008 % / час; P = 0.40). Общий вид фенилаланина снизился с 0,80 ± 0,03 до 0,75 ± 0,03 мкмоль / кг · мин после обработки ОХ ( P <0,05).

Рисунок 4.

Мышечный белок FSR. Мышечный белок FSR у пяти молодых мужчин во время постабсорбтивного состояния как до (контроль, открытая полоса ), так и после (OX, черная полоса ) введения ОХ. *, Пять дней приема OX увеличили скорость синтеза мышечных белков примерно на 44% ( P <0.05).

Рисунок 4.

Мышечный белок FSR. Мышечный белок FSR у пяти молодых мужчин во время постабсорбтивного состояния как до (контроль, открытая полоса ), так и после (OX, черная полоса ) введения ОХ. *, Пять дней приема ОХ увеличивали скорость синтеза мышечных белков примерно на 44% ( P <0,05).

Полученные с помощью модели параметры кинетики свободных аминокислот в мышцах ног пяти субъектов в контрольный период и после 5 дней ОХ показаны в таблице 2.Обработка ОХ не влияла на доставку аминокислот (F из ) или высвобождение меченого фенилаланина из ноги (F из ). Более того, скорость внутреннего транспорта (F M, A ) фенилаланина осталась неизменной. Однако 5 дней приема ОХ привели к значительному снижению скорости внешнего транспорта фенилаланина (F V, M ; P <0,05). Внутриклеточная скорость появления фенилаланина (F M, O ), показатель протеолиза, не изменилась после введения ОХ (таблица 2).Однако, в соответствии с данными прямого включения, скорость внутриклеточного использования фенилаланина для синтеза белка (F O, M ) значительно увеличилась после обработки ОХ (таблица 2; P <0,05). В результате увеличения F O, M и отсутствия изменений в F M, O чистый баланс (NB) сместился с чистого отрицательного выхода (-30 ± 6) в течение контрольного периода натощак на приблизительный нулевой баланс (-1 ± 4) во время ночного голодания после 5 дней ОХ (Таблица 2; P <0.05). Эффективность синтеза белка значительно увеличивалась от контроля до периода OX (24 ± 0,03% против 39 ± 0,07%; P <0,05). Наконец, OX не влиял на кровоток в ногах.

Таблица 2.

Влияние лечения оксандролоном на кинетику свободных аминокислот в мышцах ног у молодых мужчин

Кинетический параметр . фенилаланин .
Управление . Оксандролон .
F в (артериальное родоразрешение) 263 ± 46 227 ± 42
F из (венозный отток) 293 ± 46 228 F M, A (транспортировка внутрь) 144 ± 17 124 ± 25
F V, M (транспортировка наружу) 175 ± 15 125 ± 29 a
F V, A (функциональное шунтирование) 118 ± 35 102 ± 17
F M, O (расщепление белка) 83 ± 8 69 ± 8
F O, M (синтез белка) 53 ± 3 68 ± 5 a
Ra M (внутриклеточный вид) 228 ± 16 193 ± 32
N чистый остаток) −30 ± 6 −1 ± 4 a
Кинетический параметр . фенилаланин .
Управление . Оксандролон .
F в (артериальное родоразрешение) 263 ± 46 227 ± 42
F из (венозный отток) 293 ± 46 228 F M, A (транспортировка внутрь) 144 ± 17 124 ± 25
F V, M (транспортировка наружу) 175 ± 15 125 ± 29 a
F V, A (функциональное шунтирование) 118 ± 35 102 ± 17
F M, O (расщепление белка) 83 ± 8 69 ± 8
F O, M (синтез белка) 53 ± 3 68 ± 5 a
Ra M (внутриклеточный вид) 228 ± 16 193 ± 32
N чистый остаток) −30 ± 6 −1 ± 4 a
Таблица 2.

Влияние лечения оксандролоном на кинетику свободных аминокислот в мышцах ног у молодых мужчин

Кинетический параметр . фенилаланин .
Управление . Оксандролон .
F в (артериальное родоразрешение) 263 ± 46 227 ± 42
F из (венозный отток) 293 ± 46 228 F M, A (транспортировка внутрь) 144 ± 17 124 ± 25
F V, M (транспортировка наружу) 175 ± 15 125 ± 29 a
F V, A (функциональное шунтирование) 118 ± 35 102 ± 17
F M, O (расщепление белка) 83 ± 8 69 ± 8
F O, M (синтез белка) 53 ± 3 68 ± 5 a
Ra M (внутриклеточный вид) 228 ± 16 193 ± 32
N чистый остаток) −30 ± 6 −1 ± 4 a
Кинетический параметр . фенилаланин .
Управление . Оксандролон .
F в (артериальное родоразрешение) 263 ± 46 227 ± 42
F из (венозный отток) 293 ± 46 228 F M, A (транспортировка внутрь) 144 ± 17 124 ± 25
F V, M (транспортировка наружу) 175 ± 15 125 ± 29 a
F V, A (функциональное шунтирование) 118 ± 35 102 ± 17
F M, O (расщепление белка) 83 ± 8 69 ± 8
F O, M (синтез белка) 53 ± 3 68 ± 5 a
Ra M (внутриклеточный вид) 228 ± 16 193 ± 32
N чистый остаток) −30 ± 6 −1 ± 4 a

ОХ введение значительно увеличивало концентрации мРНК AR скелетных мышц без изменения концентраций мРНК IGF-I.На Фигуре 5 представлена ​​репрезентативная авторадиограмма гибридизации по Саузерну для AR скелетных мышц и график данных денситометрии от всех пяти субъектов. Концентрации мРНК IGF-I достоверно не увеличивались после 5 дней лечения OX (контроль, 2,3 ± 0,6; OX, 3,1 ± 0,5). Концентрация ГАП не изменилась. Данные представлены как отношение плотности полосы AR к плотности полосы GAP.

Рисунок 5.

Концентрации мРНК AR. Top , Репрезентативная авторадиограмма Саузерн-блот-гибридизации продукта RT-PCR из общей РНК биопсий мышц трех субъектов, получавших ОХ (15 мг / день в течение 5 дней).GAP использовался в качестве внутреннего контроля. C, контроль; О, ОХ. Внизу , График среднего ± стандартная ошибка всех пяти субъектов. Данные выражены в произвольных единицах, рассчитанных как отношение плотностей полос AR к плотностям полос GAP (внутренний контроль). Статистическая значимость определялась парным тестом t (*, P ≤ 0,05).

Рисунок 5.

Концентрации мРНК AR. Top , Репрезентативная авторадиограмма Саузерн-блот-гибридизации продукта RT-PCR из общей РНК биопсий мышц трех субъектов, получавших ОХ (15 мг / день в течение 5 дней).GAP использовался в качестве внутреннего контроля. C, контроль; О, ОХ. Внизу , График среднего ± стандартная ошибка всех пяти субъектов. Данные выражены в произвольных единицах, рассчитанных как отношение плотностей полос AR к плотностям полос GAP (внутренний контроль). Статистическая значимость определялась парным тестом t (*, P ≤ 0,05).

Обсуждение

Мы исследовали реакцию кинетики мышечного белка на введение OX у нормальных молодых мужчин.Мы продемонстрировали, что умеренная доза OX в течение 5 дней стимулировала анаболизм мышечного белка у молодых мужчин. Кроме того, мы впервые продемонстрировали на людях увеличение АР скелетных мышц после анаболического вмешательства. Мышечный анаболизм во время лечения ОХ происходил за счет стимуляции синтеза белка, так как распад белка не изменился. Более того, значительное снижение модельного внешнего транспорта (F V, M ) наряду с рассчитанным увеличением эффективности синтеза белка указывает на усиление внутриклеточного повторного использования аминокислот.Взятые вместе, эти результаты демонстрируют механизм анаболических свойств OX в скелетных мышцах натощак.

Недавнее исследование в нашей лаборатории (7) продемонстрировало, что через 5 дней после однократной внутримышечной инъекции ТЕ (200 мг) синтез белка FSR и модельного белка увеличился в 2 раза без изменения FBR. Кроме того, в соответствии с настоящими выводами, Ferrando et al. (7) продемонстрировал повышенное использование внутриклеточных аминокислот, показывая тесную взаимосвязь между распадом белка и синтезом белка.Хотя наши кинетические данные убедительно подтверждают эти выводы, величина синтетического ответа с OX была не такой большой, как с TE. С помощью OX мы обнаружили 44% и 28% увеличения FSR и синтеза белка, производного от модели (F O, M ), соответственно. Эти различия могут объясняться несколькими важными факторами.

В нашем предыдущем исследовании общая концентрация Т увеличилась вдвое по сравнению с физиологической нормой через 2 дня после инъекции ТЕ (2094 ± 561 нг / дл). Кроме того, T был все еще в верхнем физиологическом диапазоне (953 ± 283 нг / дл) к 5 дню и статистически отличался от концентрации T перед инъекцией (425 ± 99 нг / дл) (7).Напротив, величина ответа, которую мы обнаружили в концентрации OX в сыворотке, была намного меньше, чем у ТЕ. Например, общий OX в сыворотке, измеренный утром через 10 часов после перорального приема, был постоянным в дни 3 и 5, тогда как концентрации общего сывороточного и свободного T значительно снизились с 0 и 3 по 5 день. уровни андрогенов при лечении ОХ были намного ниже, чем при лечении ТЕ. Хотя общее воздействие андрогенов на скелетные мышцы с помощью OX могло быть значительно меньше, чем то, что мы обнаружили ранее с TE, тем не менее наблюдалось увеличение синтеза белка.Это говорит о том, что OX может оказывать большее анаболическое влияние на скелетные мышцы, чем TE, тем самым преодолевая снижение концентрации T.

Дополнительные данные указывают на то, что способ введения и метаболизм анаболического агента может определять величину разницы в синтезе белка с OX по сравнению с TE. Например, инъекции im TE вводят на липидной основе, так что они могут накапливаться в жировой ткани и медленно высвобождаться, обеспечивая длительную продолжительность действия.После внутримышечной инъекции 200 мг ТЕ уровни Т в сыворотке повышаются и могут достигать супрафизиологического диапазона в течение 24 часов после введения. В течение нескольких недель эти уровни постепенно снижаются до гипогонадальных уровней (21). В настоящем исследовании уровни OX в сыворотке на 5-й день составили 2,19 нг / дл через 10 часов после перорального приема. Однако к 18 часам уровни OX в сыворотке упали до 0,48 нг / дл, что составляет 78% снижение содержания OX в сыворотке всего за 8 часов. Из-за этого быстрого снижения уровня OX в крови может быть оправдано введение OX два раза в день для поддержания более высоких устойчивых уровней общего андрогена в крови, возможно, еще больше усиливая его анаболический эффект на скелетные мышцы.

Более того, мощная реакция синтеза белка OX была достаточной для улучшения чистого оттока аминокислот и катаболизма белков, связанных с ночным голоданием. Учитывая, что у большинства пациентов с травмами и ожогами наблюдается острая гиперкатаболизм, а у большинства больных раком и СПИДом хронический катаболизм, возможность обратить вспять неизбежную потерю безжировой массы тела с помощью пероральных анаболических агентов имеет значительные клинические последствия. Однако сроки, необходимые для накопления белка в этих группах пациентов, неизвестны.Как минимум, эффективное повторное использование внутриклеточных аминокислот необходимо для постоянного поддержания метаболического состояния (7, 22). Мы знаем, что во время голодания расщепление белка обычно намного выше синтеза белка (16, 22). Несмотря на голодание в течение ночи, у всех субъектов наблюдалось повышенное повторное использование аминокислот, поскольку внешний транспорт (F V, M ) снизился на 28% после лечения ОХ. Мы также показали увеличение эффективности синтеза белка с OX на 65%. В сочетании это могло привести к увеличению безжировой массы тела после еды.

Андрогены вызывают свой специфический ответ через AR, который, в свою очередь, регулирует транскрипцию генов-мишеней, чувствительных к андрогенам. Хотя мы знаем, что накопление ДНК необходимо для роста мышц, механизмы индуцированной андрогенами аккреции ДНК в скелетных мышцах неясны. AR (23) и мРНК AR (24) были обнаружены в скелетных мышцах человека. Однако на сегодняшний день нет исследований на людях, в которых изучалась бы реакция AR скелетных мышц на воздействие андрогенов. Более того, было высказано предположение, что предшествующее клеточное воздействие андрогенов может каким-то образом подготовить эти клетки к действию вторичных агентов, таких как IGF-I.Следовательно, вторичной целью этого исследования было изучить влияние введения ОХ на концентрации мРНК IGF-I и AR.

Недавнее исследование упражнений на крысах показало, что наращивание скелетных мышц может зависеть от увеличения количества АР (25). Inoue et al. (25) исследовали физиологическое значение увеличения AR для гипертрофии мышц, вызванной физической нагрузкой. Они определили, что андрогенный путь оказывает значительное влияние на гипертрофию мышц, вызванную физической нагрузкой, и обнаружили, что гипертрофия связана с повышенным количеством АР в тренированной мышце (25).Более того, исследование, проведенное Doumit et al. (26) обнаружили, что предварительная обработка сателлитных клеток свиней Т в течение 24 ч активирует AR, но не изменяет чувствительность этих клеток к IGF-I или другим факторам роста. Точно так же мы обнаружили повышенную экспрессию мРНК AR без изменения концентраций мРНК im IGF-I после кратковременного введения OX. Эти данные вместе с нашими выводами о повышенных концентрациях мРНК AR при кратковременном воздействии OX подтверждают утверждение о том, что AR могут прямо или косвенно регулировать накопление ДНК, необходимой для роста мышц.

Более свежие данные подтверждают взаимодополняющие роли андрогенов, AR и IGF-I. Urban et al. (5) обнаружил повышенную концентрацию мРНК IGF-I в скелетных мышцах пожилых мужчин, получавших в течение 4 недель замещающие дозы TE. Кроме того, вызывая тяжелый дефицит андрогенов у молодых мужчин в течение 10 недель, Mauras et al. (27) показал заметное снижение концентрации мРНК IGF-I и предположил, что в ткани скелетных мышц андрогены необходимы для местного производства IGF-I, независимо от продукции GH и системных концентраций IGF-I.Кроме того, новые данные этого исследования с участием мужчин с дефицитом андрогенов показывают, что АР значительно снижается в ответ на тяжелый гипогонадизм (28). Хотя нет прямых доказательств того, что OX связывается с AR, результаты настоящего исследования и данные Hayes et al. (28) предполагают, что андрогены могут действовать непосредственно через рецептор андрогенов, оказывая свое влияние на метаболизм белков. Тем не менее, мы не знаем из настоящего исследования физиологического значения повышенной экспрессии мРНК для AR.

Таким образом, это исследование демонстрирует, что ОХ, вводимый один раз в день в умеренной дозе (15 мг / день), способствует синтезу чистого мышечного белка. Более того, эти данные предполагают, что OX индуцировал увеличение экспрессии AR как механизм увеличения синтеза чистого мышечного белка.

Исследователи выражают благодарность медсестрам и персоналу Центра клинических исследований Университета Техаса за их помощь в этом проекте, Лакшми МакРэй за поддержку медсестер, Чжи Пинг Донгу и Боро Старчевичу за анализ образцов и BTG Pharmaceuticals Co., Inc., за предоставление исследуемого препарата.

1

Бродский

ИГ

,

Балагопал

П

, Наир КС.

1996

Влияние замещения тестостерона на мышечную массу и синтез мышечного белка у мужчин с гипогонадизмом — исследование центра клинических исследований.

Дж Клин Эндокринол Метаб

.

81

:

3469

3475

,2

Кацнельсон

L

,

Кинкельштайн

JS

,

Schoenfeld

DA

000,

Rosenthal

000,

Rosenthal

000,

Rosenthal

000 А.

1996

Увеличение плотности костей и безжировой массы тела при введении тестостерона у мужчин с приобретенным гипогонадизмом.

Дж Клин Эндокринол Метаб

.

81

:

4358

4365

.3

Бхасин

S

,

Storer

TW

,

Берман

N

и др.

1997

Замещение тестостерона увеличивает безжировую массу и размер мышц у мужчин с гипогонадизмом.

Дж Клин Эндокринол Метаб

.

82

:

407

413

,4

Tenover JS.

1992

Влияние добавок тестостерона на стареющих мужчин.

Дж Клин Эндокринол Метаб

.

75

:

1092

1098

,5

Городской

RJ

,

Боденбург

C

,

Gilkison

C

и др.

1995

Введение тестостерона пожилым мужчинам увеличивает силу скелетных мышц и синтез белка

.

Am J Physiol.

269

:

E820

E826

,6

Grinspoon

S

,

Corcoran

C

,

Lee

K

и др.

1996

Потеря безжировой массы тела и мышечной массы коррелирует с уровнями андрогенов у гипогонадных мужчин с синдромом приобретенного иммунодефицита истощения.

Дж Клин Эндокринол Метаб

.

81

:

4051

4058

,7

Феррандо

AA

,

Типтон

KD

,

Doyle

D

,

Phillips

SM

SM

Вулф

РУБ

.

1998

Инъекция тестостерона стимулирует чистый синтез белка, но не тканевой транспорт аминокислот

.

Am J Physiol.

275

:

E864

E871

,8

Griggs

RC

,

Kingston

W

,

Jozefowicz

RF

,

Herr

RF

,

Холлидей Д.

1989

Влияние тестостерона на мышечную массу и синтез мышечного белка.

J Appl Physiol

.

66

:

498

503

.9

Zhang

X-J

,

Chinkes

DL

,

Sakurai

Y

,

Wolfe

RR

1996

Изотопный метод измерения скорости фракционного распада мышечного белка in vivo

.

Am J Physiol.

270

:

E759

E767

.10

Berger

JR

,

Pall

L

,

Hall

CD

,

Simpson

9000 9000 DM

000 DM Дадли Р.

1996

Оксандролон при миопатии из-за СПИДа.

СПИД

.

10

:

1657

1662

.11

Демлинг

RH

, DeSanti L.

1997

Оксандролон и анаболические стероиды значительно увеличивают скорость набора веса в фазе восстановления после серьезных ожогов.

J Травма

.

43

:

47

51

.12

Wilson

DM

,

McCauley

E

,

Brown

DR

, Dudley R.

1995

Оксандролон терапия при конституциональной задержке роста и полового созревания. Кооперативная исследовательская группа «Биотехнологии».

Педиатрия

.

96

:

1095

1000

,13

Розенфельд

RG

,

Attie

KM

,

Frane

J

и др.

1998

Гормональная терапия синдрома Тернера: положительное влияние на рост взрослого человека.

J Педиатр

.

132

:

319

324

.14

Fenichel

G

,

Pestronk

A

,

Florence

J

,

Robison

9000 9000

Vt

Благоприятный эффект оксандролона при лечении мышечной дистрофии Дюшенна: пилотное исследование.

Неврология

.

48

:

1225

1226

,15

Биоло

G

,

Chinkes

D

,

Zhang

X

, Wolfe RR.

1992

Новая модель для определения in vivo взаимосвязи между трансмембранным транспортом аминокислот и кинетикой белка в мышцах.

J Parenter Enteral Nutr

.

16

:

305

315

,16

Biolo

G

,

Fleming

RYD

,

Maggi

SP

,

Wolfe

RR

.

1995

Трансмембранный транспорт и внутриклеточная кинетика аминокислот в скелетных мышцах человека

.

Am J Physiol.

268

:

E75

E84

,17

Wolfe

рупий.

1992

Индикаторы радиоактивных и стабильных изотопов в биомедицине: принципы и практика кинетического анализа.

Нью-Йорк

:

Wiley-Liss.

18

Bergstrom

J

,

Furst

L

,

Noree

L-O

, Vinnars E.

1974

Внутриклеточная концентрация свободных аминокислот в мышечной ткани человека.

J Appl Physiol

.

36

:

693

697

,19

Calder

AG

,

Anderson

SE

,

Grant

I

,

McNurlan

MA

.

1992

Определение низкого обогащения d 5 -фенилаланином (избыток 0,002–0,09 атомных процентов) после преобразования в фенилэтиламин в связи с исследованиями оборота белка с помощью газовой хроматографии / электронно-ионизационной масс-спектрометрии.

Масс-спектр Rapid Commun

.

6

:

421

424

.20

Phillips

SM

,

Tipton

KD

,

Aarsland

A

,

Wolf

SE

,

Wolf

SE

,

1997

Синтез и распад смешанного мышечного белка после упражнений с отягощениями у людей

.

Am J Physiol.

273

:

E99

E107

.21

Сокол

RZ

,

Palacios

A

,

Campfield

LA

,

Saul

C

, Swerdloff RS.

1982

Сравнение кинетики инъекционного тестостерона у эугонадальных и гипогонадальных мужчин.

Fertil Steril

.

37

:

425

430

.22

Biolo

G

,

Fleming

D

, Wolfe RR.

1998

Физиологическая гиперинсулинемия стимулирует синтез белка и увеличивает транспорт выбранных аминокислот в скелетных мышцах человека.

Дж Клин Инвест

.

95

:

811

819

,23

Кимура

N

,

Mizokami

A

,

Oonuma

T

,

Sasano

Hagura

1993 Иммуницитохимическая локализация рецептора андрогена с поликлональным антителом в тканях человека, залитых паррафином.

J Histochem Cytochem

.

41

:

671

678

.24

Chang

C

,

Kokontis

J

, Liao S.

1988

Структурный анализ комплементарной ДНК и аминокислотных последовательностей андрогенных рецепторов человека и крысы.

Proc Natl Acad Sci USA

.

85

:

7211

7215

,25

Иноуэ

K

,

Ямасаки

S

,

Fushiki

T

,

Okada

Y.Sugim 9000

1994

Антагонист рецепторов андрогенов подавляет гипертрофию скелетных мышц, вызванную физической нагрузкой.

Eur J Appl Physiol

.

69

:

88

91

.26

Думит

ME

,

Cook

DR

, Merkel RA.

1996

Тестостерон активирует рецепторы андрогенов и снижает дифференцировку миогенных сателлитных клеток свиней in vitro .

Эндокринология

.

137

:

1385

1394

.27

Маура

N

,

Hayes

V

,

Welch

S

и др.

1998

Дефицит тестостерона у молодых мужчин: заметные изменения в кинетике белков всего тела, силе и ожирении.

Дж Клин Эндокринол Метаб

.

83

:

1886

1892

,28

Hayes V, Jiang J, Urban RJ, Mauras N. IGF-I и андрогенные стероиды: синергетические эффекты у человека [Аннотация].Материалы 81-го ежегодного собрания The Endocrine Soc. 1999. с. 571.

Авторские права © 1999 Обществом эндокринологов

Дозировка оксандрина (оксандролона), показания, взаимодействия, побочные эффекты и многое другое

Предупреждения о черном ящике

Пелиоз Hepatis
  • Сообщалось о пелиозном гепатите при терапии андрогенными анаболическими стероидами В этом состоянии печень и иногда ткань селезенки заменяются цистами, заполненными кровью
  • Эти кисты иногда присутствуют с минимальной печеночной дисфункцией, но имеют были связаны с печеночной недостаточностью
  • Часто не обнаруживаются до тех пор, пока не разовьется опасная для жизни печеночная недостаточность или внутрибрюшное кровотечение
  • Прекращение приема анаболических стероидов обычно приводит к полному исчезновению поражений
Опухоли из клеток печени
  • Сообщалось об опухолях из клеток печени
  • Как правило, эти опухоли доброкачественные и андрогенозависимые, но сообщалось о смертельных злокачественных опухолях
  • Прекращение приема анаболических стероидов часто приводит к регрессу или остановке прогрессирования опухоли
  • Важно понимать, что опухоли печени связаны с андрогенами или анаболиками. тероиды гораздо более сосудистые, чем другие опухоли печени, и могут не проявлять активности до тех пор, пока не разовьется опасное для жизни внутрибрюшное кровоизлияние
Изменения липидов крови
  • Может вызывать изменения липидов крови, связанные с повышенным риском атеросклероза
  • Изменения липидов включают снижение ЛПВП и иногда повышенный уровень ЛПНП; изменения могут быть очень заметными и могут серьезно повлиять на риск атеросклероза и ишемической болезни сердца

Противопоказания

Известные или подозреваемые СА простаты или груди у мужчин

Женщины: рак груди с гиперкальциемией

Беременность

Нефроз или нефротический фаза нефрита

Гиперкальциемия

Предостережения

Повышает риск пелиоза При приеме анаболических стероидов сообщалось о гепатите и опухолях клеток печени

Риск холестатического гепатита и желтухи — прекратите прием, если появляется холестатический гепатит с желтухой или аномалия LFTS

у пациентов с СА груди — прекратить прием при возникновении гиперкальциемии

Повышает риск гипертрофии предстательной железы и СА простаты у пожилых пациентов

Одновременное введение варфарина может потребовать снижения дозы варфарина

Риск задержки роста у детей

Concurr Дозирование варфарина может привести к неожиданно высокому увеличению INR и PT

Риск отека с или без ЗСН у пациентов с ранее существовавшим заболеванием сердца, почек или печени

Не улучшает спортивные результаты

Анаболическая диета: для наращивания мышечной массы

Обзор

Диета, которая обещает превратить ваше тело в машину для сжигания жира, может показаться идеальным планом, но являются ли утверждения слишком хорошими, чтобы быть правдой? Анаболическая диета, созданная доктором.Мауро ДиПаскале гарантирует именно это.

Анаболическая диета — это низкоуглеводная диета, основанная на чередовании дней с низким и высоким содержанием углеводов.

Как врач и силовой атлет ДиПаскуале разработал анаболическую диету для тех, кто хочет набрать как можно большую мышечную массу, сохраняя при этом очень низкие запасы жира.

Он назвал свой план анаболической диетой, потому что считал, что цикл углеводов может имитировать эффекты анаболических стероидов.

Согласно ДиПаскуале, чередование углеводов позволяет сжигать больше жира в качестве топлива.Это позволяет максимально сохранить мышечную массу.

В типичной диете используются все три макроэлемента — углеводы, белок и жир. У спортсменов, тяжелоатлетов и бодибилдеров этот естественный процесс вызывает беспокойство, когда они хотят похудеть, но при этом сохранить прирост мышечной массы. Преимущество анаболической диеты в том, что она не ограничивает калорийность.

Телу необходимы калории для поддержания мышечной массы, поэтому любое уменьшение количества потребляемых калорий может привести к потере мышечной ткани.Вместо этого план обещает изменить метаболизм в пользу жира, что позволит вам есть нормальное количество калорий, но при этом будет наблюдаться снижение процента жира в организме.

Анаболическая диета проводится поэтапно. Каждый из них предназначен для поддержания, набора или снижения веса.

Поддерживающая фаза и фаза индукции

Поддерживающая фаза / индукционная фаза рекомендуется для недель с первой по четвертую с уровнем потребления калорий, в 18 раз превышающим вашу массу тела в фунтах. Он разработан, чтобы позволить вашему организму привыкнуть к низкоуглеводному потреблению в начале диеты, и используется в качестве поддерживающего уровня на протяжении всей диеты.

Объемная фаза

Затем объемная фаза следует за индукционной фазой с основной целью достижения желаемого насыпного веса. Для этой фазы нет установленного времени, так как подписчикам рекомендуется оставаться на ней до тех пор, пока не будет набран вес.

Чтобы определить ваш идеальный объемный вес, DiPasquale предлагает использовать ваш идеальный вес в фунтах, а затем добавить 15 процентов. Поскольку фаза сушки следует за фазой увеличения массы тела, считается, что превышение идеальной массы тела облегчит последующую потерю жира.

Фаза резки

Наконец, фаза резки — это, по сути, план потери веса с низким содержанием углеводов с рекомендациями сократить от 500 до 1000 калорий на этапе поддержания. Эту фазу следует проводить до тех пор, пока вы не достигнете желаемого процента жира в организме, предпочтительно менее 10 процентов.

Хотя каждая из фаз имеет разные уровни потребления калорий в зависимости от целей, пропорции макронутриентов относительно не меняются.

Анаболическая диета основана на круговороте питательных веществ: низкоуглеводная в течение недели и высокоуглеводная по выходным.Чередование дней с низким и высоким содержанием углеводов не дает организму вернуться к сжиганию в основном углеводов в качестве топлива. Дни с высоким содержанием углеводов также позволяют телу восполнить потерю топлива во время энергичных тренировок.

Для фазы буднего дня основное внимание следует уделять ограничению потребления углеводов до не более 30 граммов в день, при этом калорийность поступает в основном из жиров и белков. В идеале, расщепление должно составлять от 60 до 65 процентов жира, от 30 до 35 процентов белка и от 5 до 10 процентов углеводов.

После пяти дней низкоуглеводного питания фаза выходных предназначена для пополнения запасов углеводов в организме.От 60 до 80 процентов калорий в выходные дни должны поступать из углеводов, от 10 до 20 процентов из жиров и от 10 до 20 процентов из белков.

Анаболическая диета должна соблюдаться только в течение определенного периода времени. Это может сработать для бодибилдера или штангиста, готовящегося к соревнованиям.

Хотя диета может увеличить мышечную массу тела при одновременном уменьшении запасов жира, это не означает, что диета является здоровой. Основным недостатком анаболической диеты является отсутствие клетчатки и микроэлементов, в первую очередь из-за минимального потребления овощей, фруктов и бобовых.

В то время как фаза выходного дня допускает высокое потребление углеводов, для фазы буднего дня рекомендуется мало овощей, никаких бобовых и ноль фруктов.

Этот дисбаланс приведет к снижению потребления антиоксидантов, необходимых для борьбы с окислительным стрессом, вызванным физическими упражнениями. Поскольку в диете также не хватает клетчатки, это может привести к чрезмерному росту вредных кишечных бактерий и хроническим запорам.

Согласно некоторым исследованиям на животных, инсулин неэффективен при кетогенных диетах с высоким содержанием жиров, подобных этой.Чтобы усваивать углеводы — даже в небольших количествах в будние дни — вам нужен инсулин. Хронические диеты с высоким содержанием жиров могут привести к инсулинорезистентности, что может увеличить риск сердечных заболеваний, диабета 2 типа и метаболического синдрома.

При рекомендованных 60-65 процентах калорий, получаемых за счет потребления жиров, даже умеренное количество времени, потраченное на анаболическую диету, может привести к недостаточной функции инсулина. По мере уменьшения количества потребляемого жира функция инсулина возвращается к своему нормальному состоянию.

Пищевые жиры, особенно высокое потребление насыщенных жиров, как известно, положительно регулируют выработку тестостерона и андрогенов.

Степень этих изменений довольно мала, но ДиПаскуале твердо придерживается своей позиции, что насыщенные жиры необходимы для оптимального производства гормонов.

В будние дни он предлагает большое количество:

  • жирных кусков красного мяса
  • цельных яиц
  • жирных молочных продуктов, таких как сыр, сливки и масло
  • масла
  • орехи
  • ореховые пасты

По сравнению с моно- и полиненасыщенными жирами, насыщенные жиры повышают уровень холестерина и триглицеридов.Это увеличивает риск сердечно-сосудистых заболеваний.

Калорий: 2300

Жиры: 60–65 процентов

Белки: 30–35 процентов

Углеводы: 5–10 процентов

Прием пищи 1: Завтрак

  • 3 цельных яйца
  • 1 унция. сыр чеддер
  • 1 ст. масло
  • 2 звена колбасы из индейки, вареной

Взбить яйца и сыр. Сварить в 1 столовой ложке масла и подавать с сосисками.

Питание: 511 калорий, 43,5 г жиров, 28.7 г белков, 1,4 г углеводов

Прием пищи 2: закуска

  • 6 унций 1% творог
  • 1 ст. миндальное масло
  • 1 ст. шрот льняной
  • 1 ст. масло

Подавать творог с миндальным маслом, льняной мукой и маслом.

Питание: 410 калорий, 28,4 г жира, 28,3 г белка, 11,5 г углеводов

Прием пищи 3: обед

  • 4 унции. вареная куриная грудка
  • 1 яйцо вкрутую
  • 2 стакана салата ромэн
  • 2 ст.масло
  • 1 ст. уксус

Подавать куриную грудку и яйцо поверх салата. Перемешайте с маслом и уксусом.

Питание: 508 калорий, 35,8 г жиров, 42,5 г белка, 3,8 г углеводов

Прием пищи 4: закуска

  • 4 унции. говяжий фарш
  • 1 унция. сыр чеддер
  • 2 ст. арахисовое масло

Приготовьте говяжий фарш с сыром. Подавать с арахисовым маслом в качестве гарнира.

Питание: 513 калорий, 32,6 г жира, 49,5 г белка, 6,7 г углеводов

Прием пищи 5: ужин

  • 4 унции.вареная куриная грудка
  • 2 стакана салата ромэн
  • 1 ст. шрот льняной
  • 1 ст. масло
  • 1/2 ст. уксус

Взбейте льняную муку, масло и уксус венчиком. Перемешайте с салатом и подавайте с куриной грудкой.

Питание: 352 калории, 20,4 г жира, 38,5 г белка, 5,4 г углеводов

Хотя анаболическая диета полезна для тех, кто стремится к максимальному приросту физической формы, она не рекомендуется для конкурентоспособных спортсменов с повышенными потребностями в углеводах.Он также не идеален для людей, стремящихся исключительно к снижению веса.

Поскольку программа очень ограничена и ограничена по питательным веществам, ее следует использовать только в течение короткого периода времени для достижения конкретной цели. Для общей потери веса более рациональным и здоровым вариантом являются диеты с высоким содержанием питательных веществ в сочетании с упражнениями.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2008 - 2021 | Охотники за сердцами