Цветочная пыльца калорийность: Пыльца пчелиная — калорийность, пищевая ценность ⋙ TablicaKalorijnosti.ru

Содержание

Калорийность пыльца цветочная. Химический состав и пищевая ценность.

пыльца цветочная богат такими витаминами и минералами, как: витамином А — 11,1 %, витамином B1 — 66,7 %, витамином B2 — 83,3 %, витамином B5 — 300 %, витамином B6 — 35 %, витамином B9 — 100 %, витамином C — 111,1 %, калием — 20 %, кальцием — 57,5 %, магнием — 35 %, железом — 11,1 %
  • Витамин А отвечает за нормальное развитие, репродуктивную функцию, здоровье кожи и глаз, поддержание иммунитета.
  • Витамин В1 входит в состав важнейших ферментов углеводного и энергетического обмена, обеспечивающих организм энергией и пластическими веществами, а также метаболизма разветвленных аминокислот. Недостаток этого витамина ведет к серьезным нарушениям со стороны нервной, пищеварительной и сердечно-сосудистой систем.
  • Витамин В2 участвует в окислительно-восстановительных реакциях, способствует повышению восприимчивости цвета зрительным анализатором и темновой адаптации.
    Недостаточное потребление витамина В2 сопровождается нарушением состояния кожных покровов, слизистых оболочек, нарушением светового и сумеречного зрения.
  • Витамин В5 участвует в белковом, жировом, углеводном обмене, обмене холестерина, синтезе ряда гормонов, гемоглобина, способствует всасыванию аминокислот и сахаров в кишечнике, поддерживает функцию коры надпочечников. Недостаток пантотеновой кислоты может вести к поражению кожи и слизистых.
  • Витамин В6 участвует в поддержании иммунного ответа, процессах торможения и возбуждения в центральной нервной системе, в превращениях аминокислот, метаболизме триптофана, липидов и нуклеиновых кислот, способствует нормальному формированию эритроцитов, поддержанию нормального уровня гомоцистеина в крови. Недостаточное потребление витамина В6 сопровождается снижением аппетита, нарушением состояния кожных покровов, развитием гомоцистеинемии, анемии.
  • Витамин В9 в качестве кофермента участвуют в метаболизме нуклеиновых и аминокислот. Дефицит фолатов ведет к нарушению синтеза нуклеиновых кислот и белка, следствием чего является торможение роста и деления клеток, особенно в быстро пролифелирующих тканях: костный мозг, эпителий кишечника и др. Недостаточное потребление фолата во время беременности является одной из причин недоношенности, гипотрофии, врожденных уродств и нарушений развития ребенка. Показана выраженная связь между уровнем фолата, гомоцистеина и риском возникновения сердечно-сосудистых заболеваний.
  • Витамин С участвует в окислительно-восстановительных реакциях, функционировании иммунной системы, способствует усвоению железа. Дефицит приводит к рыхлости и кровоточивости десен, носовым кровотечениям вследствие повышенной проницаемости и ломкости кровеносных капилляров.
  • Калий является основным внутриклеточным ионом, принимающим участие в регуляции водного, кислотного и электролитного баланса, участвует в процессах проведения нервных импульсов, регуляции давления.
  • Кальций является главной составляющей наших костей, выступает регулятором нервной системы, участвует в мышечном сокращении. Дефицит кальция приводит к деминерализации позвоночника, костей таза и нижних конечностей, повышает риск развития остеопороза.
  • Магний участвует в энергетическом метаболизме, синтезе белков, нуклеиновых кислот, обладает стабилизирующим действием для мембран, необходим для поддержания гомеостаза кальция, калия и натрия. Недостаток магния приводит к гипомагниемии, повышению риска развития гипертонии, болезней сердца.
  • Железо входит в состав различных по своей функции белков, в том числе ферментов. Участвует в транспорте электронов, кислорода, обеспечивает протекание окислительно- восстановительных реакций и активацию перекисного окисления. Недостаточное потребление ведет к гипохромной анемии, миоглобиндефицитной атонии скелетных мышц, повышенной утомляемости, миокардиопатии, атрофическому гастриту.
ещескрыть

Полный справочник самых полезных продуктов вы можете посмотреть в приложении «Мой здоровый рацион».

Пчелиная пыльца — калорийность продукта на 100 грамм – Иториум

Цветочную пыльцу вырабатывают пыльники, окружающие цветочный пестик. Пчелы приносят ее на своих ножках, а пчеловоды собирают, устраивая своеобразные “препятствия” для пчелы — она просто роняет в специальный лоток часть принесенной пыльцы.
Цветочная пыльца содержит все необходимые аминокислоты, которые организм человека не может самостоятельно синтезировать. В ней обнаружено 27 микроэлементов, среди которых особенно много калия, необходимого организму для поддержания сердечной мышцы, а также железа, меди, кобальта. Есть в пыльце и жизненно необходимые для человека кальций, фосфор, магний, цинк, йод и др. Богата пыльца каротиноидами — провитамином А, витаминами группы В, витаминами С, Е, Д, Р, К и другими, фитогормонами, антибактерицидными веществами.

Присутствующий в пыльце рутин, которого в ней рекордное количество, практически выполняет программу профилактики сердечных заболеваний: он укрепляет стенки капилляров, тем самым улучшая сердечную деятельность. В цветочная пыльца найден также ряд ферментов, которые еще называют биологическими катализаторами, играющими важную роль в процессах обмена веществ. Антибактерицидные вещества пыльцы активизируют организм на борьбу с вирусами и бактериями.

Пыльца-обножка различных растений отличается по форме, цвету, величине. Содержит не менее 28 элементов таблицы Менделеева: натрий, калий, никель, титан, ванадий, хром, фосфор, циркон, берилл, бота цинк, свинец, серебро, мышьяк, олово, галлий, стронций, барий, уран, кремний, алюминий, магний, марганец, молибден, медь, кальций, железо.

Кроме того, в состав пыльцы-обножки входят практически все незаменимые аминокислоты, правда, в неодинаковых количествах. Пыльца-обножка богата биологически активными, широкого спектра действия веществами: противосклеро-тическими, капилляроукрепляющими. Есть в пыльце и изрядное количество витаминов. Прежде всего — провитамин А, а также витамины, С, Д, Е, К, РР. Кроме того, в этом продукте обнаружен стимулятор роста.

Есть в нем и ферменты, и фитонциды.

Пыльца-обножка — ценный продукт. Она применяется как для лечения различных заболеваний, так и в лечебном питании. Пыльца рекомендуется при физическом истощении организма, анемии, для восстановления сил после тяжелых заболеваний. Употребление пыльцы быстро поднимет уровень гемоглобина в крови, Пыльца повышает иммунитет, а потому советуем ее употреблять в периоды эпидемий гриппа. Для людей, склонных к депрессии, этот продукт также очень полезен.

Товар недоступен для заказа

Товар недоступен для заказа

Вы выключили JavaScript. Для правильной работы сайта необходимо включить его в настройках браузера.

Вам может понравиться:

350 р.

Пыльца- это мужские соцветия цветка собранные пчелами в горошины. Пыльца состоит из огромного колич…

170гр

270 р.

Продукт с таёжной пасеки в экологически чистом Яковлевском районе Приморья. Сбор 2020 г Рассматрив…

150г

270 р.

Продукт с таёжной пасеки в экологически чистом Яковлевском районе Приморья. Сбор 2020 г Рассматрив…

150г

270 р.

Продукт с таёжной пасеки в экологически чистом Яковлевском районе Приморья. Сбор 2020 г Рассматрив…

150г

265 р.

Пыльца – приятный и полезный натуральный продукт. Пыльцевые зерна доставляются пчелами в улей в вид…

90 р.

Пчелы – уникальное создание природы, эти маленькие жужжащие труженицы производят огромный перечень…

100 грамм

450 р.

Челы – уникальное создание природы, эти маленькие жужжащие труженицы производят огромный перечень п…

500 грамм

800 р.

Пчелы – уникальное создание природы, эти маленькие жужжащие труженицы производят огромный перечень…

70 грамм

170 р.

Пчелы – уникальное создание природы, эти маленькие жужжащие труженицы производят огромный перечень…

90 грамм

1492 р.

Пыльца Финиковой Пальмы может эффективно применяться в профилактике и лечении самых разных заболева…

90 капсул

213 р.

Пчелиная перга или пчелиный хлеб – 100 % натуральный продукт с Башкирских пасек. Она содержит витам…

50 г

149 р.

Этот натуральный продукт пчеловодства полезен, как для взрослых (женщин и мужчин), так и для детей…

50 гр

121 р.

Пчелиный воск — это натуральный продукт жизнедеятельности молодых ульевых пчёл, выделяющийся их вос…

100 г

505 р.

750мл. , пластик, крышка-сота Абсолютно все продукты жизнедеятельности медоносной пчелы полезны. Их…

244 р.

Монастырская пчелиная пыльца, собранная пчелами в предгорьях Сочи – это изумительно полезный продук…

660 р.

СОСНОВАЯ ПЫЛЬЦА В НАРОДНОМ ПРИМЕНЕНИИ (весенний сбор с горной альпийской сосны) : порошок желтого ц…

25 гр.

1317 р.

СОСНОВАЯ ПЫЛЬЦА В НАРОДНОМ ПРИМЕНЕНИИ (весенний сбор с горной альпийской сосны) : порошок желтого ц…

50 гр.

258 р.

Габариты: 6,5 x 7 x 6 см; Мин. кол-во для заказа: 1; Вес: 204 г; Страна: Россия; В боксе: 20 шт; Со…

305 р.

Рекомендовано при: анемии, для нормализации работы нервной и эндокринной систем, укрепления капилля…

250 р.

Рекомендовано при: анемии, для нормализации работы нервной и эндокринной систем, укрепления капилля…

80 гр.

262 р.

Рекомендовано при: анемии, для нормализации работы нервной и эндокринной систем, укрепления капилля…

320 р.

Только что с пасеки!СБОР 2021!Цвет этого меда может варьироваться в зависимости от пыльцы Соединени…

198 р.

Липовый мёд. Мед входит в перечень самых полезных продуктов для здоровья человека, что обусловлено…

200мл

176 р.

Конфеты ‘Здоровейка’ полезны и детям, и взрослым! Основным ингредиентом полезных конфет является цв…

100 гр.

480 р.

Выгодное предложение от производителя в соотношении цена-обьем! 250 мл., тара – пластик Настойка…

246 р.

Пергу в народе называют по-разному — ‘пчелиный хлеб’, ‘хлебина’, обножка. По сути — это цветочная…

50 гр.

229 р.

Габариты: 7,5 x 7 x 6,5 см; Мин. кол-во для заказа: 1; Вес: 132 г; Страна: Россия; В боксе: 24 шт;…

327 р.

Особенности:Эффективное натуральное средство для увлажнения и питания для всех типов кожи придаёт м…

983 р.

Пищевая добавка Серьезное питание для детей 2-10 лет Ваш ребенок заслуживает только самого лучшего…

13 x 6.6 x 6.6 cm / 0.22 кг

581 р.

Подмор пчелиный — широко известное своими целительными свойствами средство. Погибшие пчёлы (подмор…

100 м

180 р.

Габариты: 3,5 x 5 x 14 см; Мин. кол-во для заказа: 1; Вес: 82 г; Страна: Россия; В боксе: 20 шт; Со…

228 р.

Рекомендовано при:болях в суставах;ревматизме;болезнях периферической нервной системы (радикулитах…

195 р.

Удивительно полезное и вкусное лакомство с пчелиной обножкой — 100% натуральный мёд из Красной Поля…

267 р.

Рекомендовано при: высокоэффективное средство при лечении бактериальных и вирусных заболеваний, пр…

130 гр.

91 р.

Прополис пчелиный формованный 5 гр. Состав: Прополис пчелиный 100% натуральный формованный. Назначе…

5 гр.

498 р.

Натуроник» рейши – натуральный бальзам на основе ягод Гожи, гриба рейши и природных компонентов, ко…

100 г (стекло)

320 р.

Только что с пасеки!СБОР 2021!Настаивается 10дней на корне Аралии(Элеутерококк),поставщик ещё загот…

750 р. 488 р.

КардОКс представляет из себя сбалансированный комплекс исключительно натуральных продуктов пчеловод…

498 р.

Растительный комплекс «Натуроник синюха» — природное средство на основе ягод Годжи, травы синюхи и…

100 г (стекло)

492 р.

Перга с растительными добавками КардОКс КардОКс представляет из себя сбалансированный комплекс ис…

50 гранул

Мы используем метаданные (cookie, данные об IP-адресе и местоположении) для функционирования сайта. Продолжая пользоваться нашим сайтом, вы соглашаетесь с использованием метаданных Закрыть

Перга пчелиная и её полезные свойства – Наш Алтай

Одним из продуктов пчеловодства, замечательным по своим свойствам является перга. Это цветочная пыльца, переработанная пчелами и запечатанная в соты. Насекомые используют продукт в качестве пищи зимой.

Перга: состав и свойства

Состав, так называемого пчелиного хлеба, многокомпонентен. В него входит широкий диапазон аминокислот, витаминов, ферментов, фитогормонов и других не менее полезных элементов.

При существующем дефиците натуральных и полезных продуктов и перенасыщении торговых точек рафинированной пищей, сторонники полезного и здорового питания не зря считают пергу одним из самых питательных и полезных продуктов.

Что делает перга для организма:

  • — тонизирует;
  • — омолаживает;
  • — повышает иммунитет;
  • — насыщает витаминами и микроэлементами;
  • — увеличивает сопротивляемость;
  • — увеличивает продолжительность и качество жизни.
    • Калорийность продукта довольно высока: в одной столовой ложке содержится – 30 калорий. Несмотря на большое содержание калорий, принимать пергу можно даже тем, кто соблюдает диету, ведь ее ежедневное употребление обычно не превышает 1-2 ложек.

      Перга: как принимать?

      Использовать продукт можно как в целях профилактики, так и для лечения. Для предупреждения различных заболеваний и усиления защитных способностей организма, рекомендуется принимать от 10 до 15 грамм ежедневно. Лечебная доза увеличивается до 20-30 грамм. Прием перги совмещают с приемом пищи или употребляют ее натощак.

      Прием продукта в перерывах между приемами пищи может понизить давление. Людям, чувствительным к перепадам давления следует принимать хлеб пчел вместе с едой. Считается, что продукт лучше усваивается, если растворять его во рту. Но даже если просто принять пергу как обычную таблетку и запить водой эффект также будет заметен.

      Перга: хранение

      Если продукт хранить неправильно, то он может испортиться и потерять свои свойства. Пергу лучше хранить в прохладном, сухом и темном месте. Это может быть холодильник или, например, подвал. При несоблюдении благоприятных для хранения условий, продукт может быстро высохнуть или наоборот, заплесневеть.

Смузи с дыней, манго, щавелем и базиликом рецепт – Американская кухня: Напитки. «Еда»

Смузи с дыней, манго, щавелем и базиликом рецепт – Американская кухня: Напитки. «Еда»

+ Подбор рецептов

Ингредиенты, деталиПодобрать рецепты

Включить ингредиентыИсключить ингредиентыПопулярные ингредиенты

Сладкий перецСвининаЛисичкиКокосовое молокоКабачки

Тип рецепта

Показать 0 рецептовОчистить всё

Смузи с дыней, манго, щавелем и базиликом

АВТОР: Иван Соколов

порции:  4ГОТОВИТЬ:  10 минут

Добавить в книгу рецептов13

Добавить
фотоАвтор рецепта

Подписаться

История к рецепту

BEE-Pharmacy   Пчелиная пыльца —  это один из ценнейших и полезнейших продуктов пчеловодства наряду с прополисом и маточным молочком. Опыляя цветок, пчела цепляет на свои мохнатые ножки его пыльцу вырабатываемую пыльником и несёт в улей.   За многие тысячи лет пчелы выработали свою технологию ее заготовки. Рабочая пчела всего за один вылет способна принести в улей около 20 мг пыльцовых зерен. В день она делает около 10 вылетов. Пыльца в количестве 1 кг заготавливается одной пчелой за 50 тыс. вылетов. Пчелиная семья способна за день заготовить 1 кг пыльцы, а всего за сезон — около 50 кг. Пчелы собирают пыльцу в так называемые корзиночки, которые размещаются у них на задних ножках. Цветочную пыльцу они донесут до улья и обработают секретом своих челюстных желез. Заготовленная пчелиная пыльца, или обножка, затем превратится в пергу, которая станет кормом для рабочих пчел. Существует технология, позволяющая пчеловодам собирать цветочную пыльцу. Она скапливается в специальном лотке, куда пчела роняет часть принесённой пыльцы. И благодаря пчёлам мы с вами можем пользоваться этим чудесным продуктом. Пчелиная пыльца имеет в своём составе огромное количество полезных веществ. Она содержит все нужные человеческому организму незаменимые аминокислоты, все известные витамины, ценнейшие минералы и протеины. Советую не пропустить следующую ярмарку меда в Вашем городе. Всего 1-2 столовых ложек в день будет достаточно чтобы все эти минералы и витамины оказались в Вашем организме.  

Читать полностьюЭтот коктейль из всего полезного, который даст Вам бодрости на целый день

Энергетическая ценность на порцию

Калорийность

Белки

Жиры

Углеводы

ккал

грамм

грамм

грамм

* Калорийность рассчитана для сырых продуктов

Апельсины

4 штуки

Щавель

1/2пучка

Сироп агавы

2 столовые ложки

Цветочная пыльца

1 столовая ложка

Инструкция приготовления

10 минут

Распечатать

1Манго чистим и срезаем ножом кусочки среднего размера, такие чтобы перемолол блендер (манго лучше брать зеленое бразильское, а не желтое оно менее сладкое)

2Кусок дыни режем средним кусками и кидаем в блендер

3Туда же промытый щавель и базилик вместе со стеблями

4Кладем ложку пчелиной пыльцы (если ее нет можно не класть, менее вкусно не будет; чуть менее полезно только)

5Выжимаем сок из 4 апельсинов

6Выливаем в блендер туда же немного сиропа агавы (чтобы не класть сахар) можно заменит кленовым сиропом

7Все это пробиваем на высокой скорости около 5 минут и подаем украсив листиком мяты

Популярные запросы:

Комментарии (0):

Читайте также:

Рецепты шефов

Похожие рецептыАвтор: Еда

5 ингредиентов

Добавить в книгу рецептов

Автор: Еда

6 ингредиентов

Добавить в книгу рецептов

Автор: Еда

6 ингредиентов

Добавить в книгу рецептов

Автор: Солнцева Марианна

5 ингредиентов

Добавить в книгу рецептов

Автор: Еда

4 ингрендиента

Добавить в книгу рецептов

Автор: Солнцева Марианна

3 ингрендиента

Добавить в книгу рецептов

Автор: Еда

6 ингредиентов

Добавить в книгу рецептов

Автор: Солнцева Марианна

4 ингрендиента

Добавить в книгу рецептов

Автор: Еда

5 ингредиентов

Добавить в книгу рецептов

Автор: Еда

4 ингрендиента

Добавить в книгу рецептов

Автор: Еда

3 ингрендиента

Добавить в книгу рецептов

Автор: Еда

6 ингредиентов

Добавить в книгу рецептов

Сообщить об ошибке

© ООО «ЕДА.РУ», 2021. ВСЕ ПРАВА ЗАЩИЩЕНЫ. ДЛЯ ЛИЦ СТАРШЕ 18 ЛЕТ.

Мед с прополисом: полезные свойства и противопоказания

Мед — это крайне полезный продукт, об этом знает практически каждый человек. Сладкое лекарство успешно применяется с давних времен. Но что собой представляет мед с прополисом? Если правильно смешать эти два компонента, то на выходе получится еще более полезная смесь. Давайте выясним, какую пользу и вред несет в себе смесь меда с прополисом.

Содержание:

Что называют прополисом?

Прополис может еще называться пчелиным клеем, поскольку он используется для запечатывания щелей и прочих повреждений в улье. Также пчелы с его помощью обеззараживают соты, в которых будет находиться потомство, используют для изоляции посторонних предметов в улье. Внешне прополис напоминает смолистое вещество. Оно бывает от темно-зеленого до темно-коричневого цвета.

Главной его задачей является антисептическое действие, которое достигается путем модификации полученного экстракта с почек растений через воздействие пчелиными ферментами.

С одного улья можно собрать за год до 150 г этого вещества. Перед тем как приготовить мед с прополисом, пчеловоды растапливают прополис на водяной бане и убирают механические примеси и только потом смешивают с медом в необходимой пропорции.

Состав смеси

Полезные свойства меда с прополисом активно используют в разных сферах жизни. Дополнительный компонент, являющийся природным антибиотиком, в несколько раз увеличивает и без того целебные свойства меда. В приготовленную смесь входят: цветочная пыльца, эфирные масла, воск, смолы, антибиотические вещества, витамины С, В, РР, В1 и В2.

Также в составе присутствуют такие компоненты:

  • минеральные вещества: Na, K, P, Mg, Fe;
  • ферменты: мелаза, каталаза, инвертаза, а также диастаза;
  • аминокислоты: лейцин, метионин, треонин, лизин, изолейцин и фениланин;
  • органические кислоты: янтарная, муравьиная, лимонная и яблочная.

В 100 г этого продукта содержится:

  • белков до 0,3 г;
  • жиров 0,00 г;
  • углеводов до 70 г;
  • калорий 324.

Выбор качественного продукта

Важно знать, как выглядит мед с прополисом и чем он отличается от привычного пчелиного продукта. Это способствует правильному выбору при покупке готового целебного средства. Натуральный продукт можно определить следующим образом:

  • Цвет. Каждый сорт меда отличается внешне: подсолнечный имеет желтый оттенок, гречишный – коричневый, цветочный – нежно желтый и т.д. От выбранного сорта будет зависеть цвет смеси меда с прополисом, также не забывайте о том, что натуральный продукт в любом случае засахарится и цвет может измениться.
  • Аромат и вкус. Лишь натуральный продукт обладает ароматным запахом (как у бальзамных настоек) и слегка горьковатым вкусом.

Чтобы гарантировано получить качественный продукт, существует два способа покупки:

  1. Аптеки.
  2. Магазины по сбыту продуктов пчеловодства.

Приготовление

Перед тем как сделать мед с прополисом самостоятельно, важно определиться с целями его использования. Так для профилактики будет достаточно 1-3% содержания прополиса. Для лечебных целей это значение может доходить до 20%. Наиболее распространенным является 5% состав, его и рассмотрим.

Берется 10 г прополиса, тщательно измельчается и растапливается на водяной бане при температуре не более 50 градусов. Далее хорошо помешивая, добавляется 200 г меда. Продолжайте подогревать смесь меда с прополисом до получения однородной массы при тех же условиях. Таким же образом готовится состав с большим и меньшим содержанием прополиса.

Полезные и лечебные свойства

Полезные и лечебные свойства меда с прополисом позволяют:

  • повысить иммунитет;
  • уменьшить болевые ощущения при стоматите;
  • избавить от неприятного зуда, покраснения кожи и прочих признаков грибка;
  • разгладить мимические морщины;
  • снизить давление, обеспечивая продолжительный результат;
  • нормализовать сердцебиение и пульс;
  • очистить сосуды, предотвращая появление бляшек;
  • использовать при лечении ожогов и обморожениях кожи, заживлении ран;
  • увеличить сопротивляемость организма, ускоряя процесс выздоровления;
  • предупредить развитие болезней дыхательной системы;
  • благотворно влиять на ЖКТ.

Употребление: показания и противопоказания

Принимать мед с прополисом в качестве профилактики очень просто, достаточно употреблять 1 ч. л. этого компонента до двух раз в день.

Помимо перечисленных полезных свойств у меда с прополисом существуют и противопоказания. Нельзя принимать в пищу состав, если есть аллергия на его компоненты. Также важно знать, что это достаточно тяжелый продукт, поэтому злоупотреблять им не стоит. В противном случае может начаться вялость, тошнота и отсутствие аппетита. Не стоит давать детям до 3 лет, а так же употреблять беременным женщинам и мамам в период лактации.

Применение

Мед с прополисом рассчитан для внутреннего и наружного использования. Он эффективен при воспалении глаз (конъюнктивите) и полости рта, при рините и покраснении горла. Он также активно используется в области гинекологических заболеваний.

Внутреннее применение чаще всего заключается в полном растворении в ротовой полости (не глотать!) 1/2 ч. л. этого вещества несколько раз в день. Поскольку сфера использования достаточно широка, поэтому нет определенного графика приема. Он индивидуален для каждого случая.

Условия хранения

Храниться данный состав может достаточно длительное время без потери полезных свойств (в течение года). Для этого понадобится стеклянная герметичная емкость и темное прохладное место.

Мед с прополисом представляет собой универсальное средство, которое используется повсеместно. Такой состав богат на витамины, минералы и кислоты, поэтому крайне полезен для человеческого здоровья. Чтобы это сладкое лекарство приносило пользу, необходимо не превышать его рекомендуемую дозу.

Что еще почитать

полезное влияние на организм, особенности. Как применять?

По количеству полезных компонентов пыльца не уступает меду. Если соединить эти 2 компонента вместе, то можно получить мощный натуральный биостимулятор, обладающий уникальными способностями. Вкус меда с пыльцой довольно своеобразный. Достаточно попробовать его один раз, чтобы стать почитателем этого продукта на долгие годы.

Что такое пыльца

Она представляет собой пыльцевые зерна различных цветков. Ее химический состав довольно богат. Ученые насчитывают более двухсот полезных компонентов, среди которых присутствуют полиненасыщенные жиры, натуральные гормоны, аминокислоты и витамины. Что касается аминокислот, то они представлены в пыльце в полном составе. Их полезное действие трудно переоценить, так как эти вещества участвуют в клеточном обмене и насыщают клетки кислородом. Недаром цветочную пыльцу советуют употреблять людям старшего возраста, так как этот продукт запускает процесс омоложения и восстановления разрушенных тканей внутренних органов.

Некоторые витамины, присутствующие в пыльце, представлены в гораздо большем количестве чем в меде. Например, довольно редкий витамин Р представляет собой мощный иммуностимулятор. Благодаря его действию, организм человека становится способным противостоять самым жестоким инфекциям и вирусам. Кроме этого, благодаря рутину, заметно укрепляются капилляры и стенки сосудов.

Заболевания, которые лечит пыльца

Благодаря богатому составу, этот продукт может не только противодействовать новым заболеваниям, но и лечить уже имеющиеся:

  • Очень полезно употреблять пыльцу во время менопаузы, так как в ее составе содержатся фитогормоны, способные нивелировать многие негативные проявления климакса.
  • Этот продукт очищает и укрепляет стенки сосудов. Пыльцу следует употреблять в качестве пищевой добавки если ежедневное меню состоит из продуктов, не обеспечивающих организм достаточным количеством витаминов и микроэлементов.
  • Благодаря огромному содержанию такого микроэлемента, как цинк, улучшается функционирование половой сферы как у мужчин, так и у женщин. Особенно он полезен при проблемах с мужским здоровьем, так как увеличивает подвижность сперматозоидов.
  • Врачи рекомендуют этот продукт хроническим алкоголикам и людям с заболеваниями поджелудочной железы. Пыльца благоприятно воздействует на органы желудочно-кишечного тракта, поврежденные длительным приемом спиртных напитков. При постоянном употреблении пыльцы, поджелудочная железа оздоравливается и восстанавливает свои функции.
  • Благодаря рутину, человек быстро восстанавливается после травм любого характера. Это крайне важно для спортсменов и людей, чья профессиональная деятельность сопряжена с риском.

С давних времен беременные женщины употребляли цветочную пыльцу, чтобы избежать выкидыша на ранних сроках. В ее составе присутствует большое количество фолиевой кислоты, отвечающей за развитие и сохранение плода.

Запрещено к использованию

Из-за огромного количества витамина А в составе цветочной пыльцы ее нельзя использовать людям с плохой сворачиваемостью крови. При склонности к аллергии, этот продукт лучше не употреблять. Цветочная пыльца – довольно сильный аллерген, который в некоторых случаях может вызвать серьезный приступ. В ее составе также содержится глюкоза, которую крайне не рекомендуется употреблять больным сахарным диабетом.

Для того чтобы предупредить аллергическую реакцию и проверить индивидуальную переносимость цветочной пыльцы, следует провести тест на чувствительность. Для этого на протяжении трех дней употребляют по одной чайной ложке продукта и наблюдают за реакцией организма. Если в течение пяти дней ничего не произошло, то этот продукт можно есть без опаски.

Состав меда

Он содержит массу незаменимых витаминов, микроэлементов и других полезных веществ. Среди их многообразия в нем содержится больше всего:

  • Фолиевой кислоты.
  • Витамина А, эффективно восстанавливающего ткани всех внутренних органов и участвующего в регенерации кожного покрова.
  • В этом продукте представлена вся группа витаминов Б. Кроме того их содержание в 100 г меда превышает 260 мкг.
  • Среди минералов в наибольшем количестве содержатся фосфор, железо, цинк и кальций.

В ста граммах продукта содержится 80 г углеводов, 90 мг белков и ни одного грамма жиров. Калорийность меда довольно высока и составляет около 310 килокалорий на 100 г.

Полезные свойства

Он входит в состав многих рецептов народной медицины, рекомендуемых при различных заболеваниях. Наиболее известны общеукрепляющие и восстанавливающие свойства этого продукта. Его рекомендуют употреблять при всех простудных заболеваниях, а также ангине, бронхите и воспалении легких.

Если ежедневно съедать около 30 г меда на протяжении года, то можно заметно улучшить состав крови и ускорить обмен веществ. Это свойство крайне необходимо больным сердечно-сосудистыми заболеваниями и со склонностью к образованию тромбов. Известны его уникальные противовоспалительные свойства, которые используются при лечении заболеваний желудочно-кишечного тракта.

Мед входит в состав старинных рецептов омолаживания организма, которые дошли до наших времен. Например, смесь пчелиного продукта с чесноком и лимоном, употребляемая ежедневно утром натощак представляет собой мощный очищающий эликсир, восстанавливающий многие функции.

Кроме того, мед используется не только вовнутрь, но и наружно. Из него готовят компрессы, мази и растирки от артроза, артрита, лишая, целлюлита и многое другое.

Противопоказания к применению

К сожалению, у некоторых людей присутствует аллергия на продукты пчеловодства. Чтобы выявить переносимость меда, проводят тест. На внутреннем сгибе локтя делают мазок и следят за реакцией кожи. Если в ближайшее время не появилось покраснение или отек, то этот продукт можно употреблять.

Больным сахарным диабетом следует быть осторожными при его использовании. В нем содержится довольно большое количество глюкозы, которая нежелательна для больных диабетом. А также высокая калорийность должна учитываться при употреблении этого продукта больными с ожирением.

Мед с пыльцой

Его можно приобрести уже готовым или сделать самим. Как приготовить мед с пыльцой? Для этого берется любой жидкий мед и отдельно покупается цветочная пыльца. Оба продукта смешиваются в одной емкости и хранятся как обычный мед. Следует учитывать, что пыльца имеет довольно непродолжительный срок годности. В отличие от меда он составляет не более 4 месяцев. Наилучшим вариантом для хранения будет холодильник, где смесь продержится более 6 месяцев.

Рецепты использования

Свойства меда с пыльцой трудно переоценить. Его можно употреблять в качестве общеукрепляющего средства в количестве не более одной столовой ложки в сутки. Нельзя смешивать мед с горячим чаем, так как большинство полезных компонентов будет уничтожено, а сам продукт приобретет вредные токсины.

Народная медицина предлагает несколько рецептов приготовления полезного состава:

  • При заболеваниях желудочно-кишечного тракта употребляют сосновую пыльцу с медом в жидком виде на протяжении нескольких дней. Для этого небольшая часть меда смешивается в чашке теплой воды и пьется в промежутках между приемами пищи. Ежедневно можно употреблять не более трех стаканов.
  • От повышенного давления отлично зарекомендовал себя отвар из мяты с добавлением кожуры лимона и меда с пыльцой.
  • Детям с железодефицитной анемией желательно применять этот продукт ежедневно. Для удобства его смешивают с теплой водой и дают выпить в жидком виде.
  • Из меда с цветочной пыльцой делают отличные маски для лица и улучшают состояние волос.

При колите его смешивают с натуральным соком, выдавленным из одного яблока, и употребляют один раз в сутки натощак. А также жидким раствором можно полоскать горло при ангине и лечить стоматит. Несмотря на то что о полезных свойствах меда с пыльцой было известно еще с давних времен, до сих пор современные ученые продолжают открывать все новые и новые уникальные возможности этого продукта.

калорий в 100 г пчелиной пыльцы и пищевая ценность

База данных продуктов и счетчик калорий Источник: Общий

Пищевая ценность

Сумма на порцию

калорий

314

% дневных значений *

Всего жиров

4.9 г

6%

Насыщенные жиры

3,465 г

17%

Транс Жир

Полиненасыщенные жиры

0,54 г

Мононенасыщенные жиры

0,495 г

Холестерин

0 мг

0%

Натрий

5 мг

0%

Всего углеводов

43.5 г

16%

Пищевые волокна

7,7 г

28%

Сахар

35,8 г

Белок

24,1 г

Витамин D

Кальций

81 мг

6%

Утюг

6,3 мг

35%

Калий

222 мг

5%

Витамин А

0 мкг

0%

Витамин C

50 мг

56%

16%

RDI *

(314 калорий)

Распределение калорий:

Углеводы (55%)

Жиры (14%)

Белки (31%)
* На основе РСНП в 2000 калорий
Фото
Сводка о питании:

калорий

314

жир

4.9 г

Углеводы

43,5 г

Белок

24,1 г

В 100 граммах пчелиной пыльцы 314 калорий, калорий.
Распределение калорий: 14% жира , 55% углеводов, 31% белка.
Другие распространенные размеры порции:
Похожие типы меда:
Похожие типы закусок:
См. Также:


Другая недавно популярная еда:

Обратите внимание, что некоторые продукты могут не подходить для некоторых людей, и вам настоятельно рекомендуется проконсультироваться с врачом, прежде чем начинать какие-либо усилия по снижению веса или соблюдать диету.Хотя информация, представленная на этом сайте, представлена ​​добросовестно и считается правильной, FatSecret не делает никаких заявлений и не дает никаких гарантий относительно ее полноты или точности, и вся информация, включая пищевую ценность, используется вами на ваш страх и риск. Все товарные знаки, авторские права и другие формы интеллектуальной собственности являются собственностью соответствующих владельцев.

калорий в пчелиной пыльце и пищевая ценность

База данных продуктов и счетчик калорий Источник: Общий

Пищевая ценность

Сумма на порцию

калорий

16

% дневных значений *

Всего жиров

0.24 г

0%

Насыщенные жиры

0,173 г

1%

Транс Жир

Полиненасыщенные жиры

0,027 г

Мононенасыщенные жиры

0,025 г

Холестерин

0 мг

0%

Натрий

0 мг

0%

Всего углеводов

2.18 г

1%

Пищевые волокна

0,4 ​​г

1%

Сахар

1,79 г

Белок

1,2 г

Витамин D

Кальций

4 мг

0%

Утюг

0,32 мг

2%

Калий

11 мг

0%

Витамин А

0 мкг

0%

Витамин C

2.5 мг

3%

1%

RDI *

(16 калорий)

Распределение калорий:

Углеводы (55%)

Жиры (14%)

Белки (31%)
* На основе РСНП в 2000 калорий
Фото
Сводка о питании:

калорий

16

жир

0.24 г

Углеводы

2,18 г

Белок

1,2 г

В 1 чайной ложке пчелиной пыльцы 16 калорий .
Распределение калорий: 14% жира , 55% углеводов, 31% белка.
Общие размеры порции:
Похожие типы меда:
Похожие типы закусок:
См. Также:


Другая недавно популярная еда:

Обратите внимание, что некоторые продукты могут не подходить для некоторых людей, и вам настоятельно рекомендуется проконсультироваться с врачом, прежде чем начинать какие-либо усилия по снижению веса или соблюдать диету.Хотя информация, представленная на этом сайте, представлена ​​добросовестно и считается правильной, FatSecret не делает никаких заявлений и не дает никаких гарантий относительно ее полноты или точности, и вся информация, включая пищевую ценность, используется вами на ваш страх и риск. Все товарные знаки, авторские права и другие формы интеллектуальной собственности являются собственностью соответствующих владельцев.

Так много пыльцы, так мало питания

В задней части кормового магазина, где поддоны с пятидесятифунтовыми мешками поднимаются до потолка и ситцевый кот дремлет на весах, я наблюдаю, как две женщины одержимы марками рационов несушек.Насколько я могу слышать, они сравнивают содержание протеина в различных марках. Это имеет смысл. Если вы хотите здоровых цыплят и много яиц, вашим птицам необходим сбалансированный рацион, включающий необходимый тип и количество белка. То же самое работает с лошадьми, свиньями, собаками, кошками и даже с вашими детьми.

Хотя мы часто говорим о содержании белка в продуктах питания, наиболее важным является выбор аминокислот. Белки состоят из цепочек аминокислот. Когда животному нужен определенный белок, оно может взять аминокислоты, которые оно съело, и связать их вместе, чтобы построить белок.Еще более удивительно то, что если животное съедает один белок, оно может разобрать его и перетянуть аминокислоты, чтобы получить другой белок — тот, который ему действительно нужен. Это немного похоже на Lego: вы используете отдельные части (аминокислоты) для создания желаемого объекта (белка).

Медоносным пчелам также необходим правильный набор аминокислот, чтобы быть здоровыми. За исключением следовых количеств меда, пыльца является единственным источником аминокислот в рационе медоносных пчел. И точно так же, как людям, чтобы оставаться здоровыми, нужна разнообразная пища, пчелиным семьям нужны разные типы пыльцы.

Разнообразие важно, потому что не все аминокислоты содержатся в одном типе пыльцы. Некоторые из них имеют больший ассортимент, чем другие, поэтому употребление в пищу различных типов пыльцы — залог хорошего питания колонии. В природе это не составит труда. Но во многих современных условиях, особенно в тех, где обитает небольшое количество цветущих видов, пчелы могут испытывать недостаток в одной или нескольких незаменимых аминокислотах. Нехватка может означать, среди прочего, сокращение продолжительности жизни, меньшую сопротивляемость болезням или плохую способность собирать пищу.

Пыльца и выращивание выводков

Как пчеловоды, мы знаем, что пыльца необходима для выращивания расплода. Но как это работает? Оказывается, самые молодые личинки медоносной пчелы не поедают пыльцу напрямую. Вместо этого пчелы-кормилицы едят пыльцу в виде пчелиного хлеба. Такая богатая белком диета стимулирует их гипофарингеальные железы к выделению маточного молочка, которое затем скармливается молодым личинкам. 1 Примерно через три дня небольшое количество пыльцы и разбавленного меда подмешивают в корм для расплода рабочих и трутней, в то время как молодые королевы продолжают питаться чистым маточным молочком.

Взрослые работники едят почти исключительно высококалорийный мед. Поскольку собиратели не едят непосредственно пчелиный хлеб или пыльцу, когда им действительно нужен белок, они упрашивают пчел-нянек. 2 Хотя мы часто это не принимаем во внимание, пчелы-кормилицы время от времени кормят всех членов семьи.

В магазине выглядело хорошо

Поскольку сборщики пыльцы ее не едят, они иногда не слишком разборчивы в том, что собирают. Иногда фуражиры приносят домой другой материал — например, опилки или кофейную гущу — порошкообразной консистенции и нужного размера частиц.Это привело некоторых исследователей к мнению, что медоносные пчелы не могут определить пищевую ценность пыльцы: если она похожа на пыльцу, значит, она хороша.

Хотя собиратели иногда собирают пыльцу плохого качества или не пыльцу, пчелы-кормилицы — те, которым действительно приходится есть этот материал, — гораздо более избирательны. Подумайте о маме, которая возвращается с рынка с пастернаком и брюквой. Дети усмехаются: « Правда? Где еда ? » На самом деле пчелы-кормилицы часто выбрасывают некоторые из сокровищ, которые их сестры приносят домой с поля, особенно вещи, не имеющие пищевой ценности, или даже этот дорогой заменитель пыльцы.

Но недавние исследования показывают, что когда дело доходит до фактической пыльцы, даже пчелы-кормилицы не могут определить ее качество. Или, даже если они признают низкое качество, они не могут передать эту информацию собирающим растениям, которые ее тащат. 3 Короче говоря, поскольку мы не можем полагаться на то, что колония сможет адекватно сбалансировать свой собственный рацион, разнообразие выбора пыльцы лучшее решение.

Потребность зависит от выращивания выводка

Когда вы поймете, как пыльца используется в улье, вы поймете, почему колонии не нужны большие запасы пыльцы зимой.С поздней осени до середины зимы, когда расплода мало, колония может обойтись минимумом пыльцы. Однако в течение основных периодов выращивания расплода, особенно поздней зимой и ранней весной, необходимы кучи пыльцы хорошего качества.

Когда пыльцы мало, колония может быть вынуждена жить за счет белковых запасов, хранящихся в виде вителлогенина в жировых телах рабочих пчел. Но это предложение ограничено, поэтому пчеловоды часто выбирают заменители пыльцы до того, как начнутся основные потоки.

Изменяющаяся среда

Легко попасть в ловушку, если подумать, что, поскольку наши отцы, деды и двоюродные деды никогда не беспокоились о питании пчел, мы тоже не должны этого делать. В то время пчелы сами собирали пыльцу и процветали. Никто не высказал двух мыслей о его источнике или содержании аминокислот.

Хотя это может быть правдой, за прошедшие годы мы существенно изменили окружающую среду. Городские районы больше не разделены большими участками естественной растительности.Фермы больше не выращивают впечатляющие урожаи. И обочины больше не представляют собой сверкающие полевые цветы. Нет. Вместо этого мы сажаем на огромных просторах одну вещь и отравляем все остальное, пока ландшафт не станет однородным и легким в управлении. Пчелиное питание? Какая разница?

Нехватка качественной пыльцы — относительно новая проблема для пчеловодов. Сегодня обильные и разнообразные источники пыльцы часто отсутствуют. Утрата среды обитания, инвазивные растения, монокультурное земледелие и гербициды — вот лишь некоторые из причин.

Биоразнообразие и здоровье пчел

Одним из основных показателей здоровой окружающей среды является биоразнообразие. Биоразнообразие — это просто сумма всего живого на определенной территории. Площадь может быть размером с землю или размером с каплю воды в пруду.

Сумма живых существ в любой естественной системе включает растения, животных, грибы и микробы. В первозданном природном сообществе каждый из видов находится в равновесии с другими. Они живут вместе, сражаются, соревнуются за ресурсы, поедают друг друга, умирают и собирают мусор в зависимости от сезона.Каждый вид выполняет особую функцию в сообществе, и ни один вид не готов взять верх. С экологической точки зрения, чем больше разнообразия, тем лучше.

Современные фермы — это полная противоположность окружающей среде. Но это далеко не плохо, современные фермы необходимы, чтобы прокормить растущее население. Тем не менее, пчеловодам важно понимать, что сельскохозяйственная среда неблагоприятна для пчел. Независимо от использования пестицидов, самая большая опасность для пчел в сельском хозяйстве — это низкое разнообразие цветковых растений. 4

Низкорослые монокультурные культуры

Для пчел пыльца цветковых растений является практически единственным источником белка, липидов, витаминов и минералов. Но в современных сельхозугодиях разнообразие подавлено. Производителю необходимо свести к минимуму конкуренцию со стороны сорняков, но он также хочет защитить свой урожай от придорожных растений, которые могут содержать болезни и вредных насекомых.

Пчелиные семьи, опыляющие монокультуры на больших площадях, такие как миндаль, сильно отличаются друг от друга в рационе.Точно так же, как один фрукт или овощ не удовлетворяет все ваши потребности в питании, пчелам недостаточно одного вида пыльцы. Опыление этих культур колониями медоносных пчел — это нормально, если пчеловод понимает пищевой стресс, который может вызвать монокультура.

Пыльца разных растений сильно различается как по количеству, так и по качеству белка. Исследователи обнаружили, что содержание белка может составлять от 2 до 61% от сухого веса, в зависимости от вида. 5 Кроме того, в зависимости от источника белка, в нем может полностью отсутствовать часть аминокислот, необходимых для правильного роста и развития.

Примером посредственного источника пыльцы является одуванчик обыкновенный, Taraxacum . Пчелы любят одуванчики, и они в большом количестве порхают с одного цветка на другого. Но в одуванчиках отсутствуют некоторые незаменимые аминокислоты. Исследования показали, что диета, состоящая из чистой пыльцы одуванчика, будет препятствовать развитию личинок у каменщиков, 6 предотвращать производство расплода у медоносных пчел, 7 и вызывать 100% отторжение личинок у шмелей. 8

Означает ли это, что одуванчики вредны для пчел? Конечно, нет.Следует помнить, что….

(PDF) Пыльца: питание, функциональные свойства, здоровье

Книга о пыльце, глава 2

Наука о продуктах пчеловодства, апрель 2016 г. 25

70. JORDE, W; LINSKENS, HF (1974) Zur Persorption von Pollen und Sporen durch die intakte Darmschleimhaut.

Acta Allergologica 29: 165-175.

71. JUZWIAK, S (1993) Экспериментальная оценка влияния экстракта пыльцы на течение отравления парацетамолом

(на польском языке; аннотация на английском языке).Annales Academiae Medicae Stetinensis 39: 57-69.

72. КАЧАНЕВА, М; РОВНА, К; АРПАСОВА, Н; HLEBA, L; ПЕТРОВА, Дж; HASCIK, P; КУБОН, Дж;

ПАВЕЛКОВА, А; CHLEBO, R; БОБКОВА, А; STRICIK, M (2013) Влияние экстрактов пчелиной пыльцы на

микрофлору желудочно-кишечного тракта цыплят-бройлеров. Исследования в области ветеринарии 95 (1): 34-37.

73. KAHLERT, H; СТЮ, Н Т; КРОМВЕЛЛ, О; FIEBIG, H (1999) Реактивность Т-клеток с аллергеном пыльцы травы

, экстрактом и аллергоидом.Международный архив аллергии и иммунологии 120 (2): 146-157.

74. КАСЯНЕНКО, В; КОМИСАРЕНКО, И; ДУБЦОВА, Е. (2010) Влияние меда, пыльцы и перги на уровень холестерина в сыворотке крови

пациентов с патологическим липидным обменом (русский язык), Пчеловодство, апитерапия и качество жизни

, Международная промышленная академия, Москва, 20 мая 2010 г .: стр 81 -82.

75. KEDZIA, B (2008) Химический состав и адаптогенная активность собранной пыльцы медоносных пчел: часть

первая: адаптогенная активность.Postepi fitoterapii 2: 115-124.

76. КЭМПФ, М; РЕЙНХАРД, А; BEUERLE, T (2010) Пирролизидиновые алкалоиды (PA) в меде и пыльце — требуется законодательное регулирование

уровней PA в пищевых продуктах и ​​кормах для животных. Молекулярное питание и исследования пищевых продуктов 54 (1): 158-168.

77. ХАН, Н; AFAQ, F; МИХТАР, H (2006) Апоптоз от диетических факторов: самоубийственное решение для задержки роста рака

. Канцерогенез 28: 233-239.

78. ХИНЧИ, М; ПОУЛСЕН, L; КАРАТ, F; АНДРЕ, К; HANSEN, A; MALLING, H (2002) Клиническая эффективность

сублингвальной и подкожной аллерген-специфической иммунотерапии пыльцой березы: рандомизированный, контролируемый плацебо

, двойной слепой, двойной манекен.Аллергия 59: 45-53.

79. КИМ, Л; РИДЛИНГЕР; J.BALDWIN, C; ХИЛЛИ, L; ХАЛСА, С; МЕССЕР, S; WATERS, R (2005) Лечение сезонного аллергического ринита

с использованием гомеопатического препарата общих аллергенов в Юго-Западном регионе

США: рандомизированное контролируемое клиническое испытание. Анналы Фармакотер 39: 617-624.

80. KLIPPEL, K; HILTL, D; SCHIPP, B (2003) Многоцентровое плацебо-контролируемое двойное слепое клиническое испытание & beta; —

ситостерола (фитостерола) для лечения доброкачественной гиперплазии предстательной железы.Британский журнал Урола 3: 427-432.

81. KOC, A N; КРЕМНИЙ, S; КАСАП, Ф; HORMET-OZ, H T; МАВУС-БУЛДУ, H; ERCAL, BD (2011) Противогрибковое средство

Активность продуктов пчеловодства против Candida spp. и Trichosporon spp. J.Med.Food (7): 1-7.

82. КОЛЕСАРОВА, А; БАКОВА, З; КАПКАРОВА, М; ГАЛИК, Б; ЮРАЧЕК, М; СИМКО, М; TOMAN, R;

СИРОТКИН А.В. (2013) Потребление пчелиной пыльцы влияет на функции яичников крыс. Журнал животных

Физиология и питание животных 97 (6): 1059-1065.

83. КОСЛИК, С; TAKAC, M (1979) Beeinflussung der Hypertriglyzeridämie und Urikämie von dauerdialysebehandelten

Patienten durch Пыльца. Das Deutsche Gesundheitswesen 34 (38): 1850–1853.

84. КОСМИДЕР, К; WOJCICKI, J; САМОЧОВЕЦ, L; ВОЙК, М; GORNIK, W (1983) Эффект цернилтона на агрегацию тромбоцитов

in vivo. Herba Polonica 29: 237.

85. KROYER, G; HEGEDUS, N (2001) Оценка биоактивных свойств экстрактов пыльцы в качестве функциональной диетической добавки

.Инновационная наука о продуктах питания и новые технологии 2 (3): 171-174.

86. ЛАРСЕН ТД; POULSEN LK; MELAC M; КОМБЕБИАС А; АНДРЕ С; MALLING HJ (2006) Безопасность и переносимость

таблеток пыльцы травы в сублингвальной иммунотерапии — исследование фазы 1. Аллергия 61: 1173-1176.

87. LE BLANCA, B; ДЭВИС, О; BOUE, S; DE LUCCA, A; DEEBYA, T (2009) Антиоксидантная активность пустыни Сонора

Пчелиная пыльца. Food Chem doi: 10.1016 / j.foodchem.2009.01.055

88.ЛЕЯ, М; МАРЕЧЕК, А; WYZGOLIK, G; KLEPACZ-BANIAK, J; CZEKONSKA, K (2007) Антиоксидантные

свойства пчелиной пыльцы в отдельных видах растений. Пищевая химия 100 (1): 237-240.

Сколько калорий в пчелиной пыльце

911

0 Разбивка

9000

1

Калорий

15,7

Калорий от жира

2.2

Жиры

0,25

г

0

%

Насыщенные жиры

0 0,17

0 0,17

%

Полиненасыщенные жиры

0,027

г

Мононенасыщенные жиры

0.025

г

Холестерин

0,0

мг

0

%

Натрий

54

мг

0

%

Калий

11,1

мг

0

%

Углеводы

2

г

1

%

Пищевые волокна

0,38

г

2

%
54 900

1,2

г

2

%

Спирт

0,0

г

9000 4% 13
A

0

%

Кальций

0

%

Витамин D

0

%

1

Ниацин 9 0025

1

%

Витамин B6

1

%

Фосфор

0

%
%

0

%
E0004

11

E0004

11 900

1

  • 0

    Марганец

  • Витамин C

    4

    %

    Железо

    2

    %
    %
    %

    Рибофлавин

    3

    %

    Витамин B12

    0

    %
    %
    %

    Медь

    4

    %

    Магний

    1

    %

    Цинк

    2

    %
    900
    Калорий

    16

    Жир

    0.2

    2

    16

    %
    Насыщенные

    0,2

    2

    11

    %

    04 0,011

    полиненасыщенные

    0,011

    0

    2

    %
    Мононенасыщенные

    0,0

    0

    2

    %
    Углеводы

    2.2

    7

    50

    %
    Пищевые волокна

    0,4 ​​

    Белок

    1,2

    4

    %
    Спирт

    0,0

    0

    0

    %
    at (

    16

    %)

    Углеводы

    (

    50

    %)

    Белок

    (

    34

    %)

    Спирт

    (

    0

    %)

    Расщепление жиров

    Насыщенные жиры

    1.6

    0,17

    Полиненасыщенные жиры

    0,24

    0,027

    Мононенасыщенные жиры

    0,22

    54

    0

    0

    0

    Насыщенные жиры

    (

    0,17

    г)

    Полиненасыщенные жиры

    (

    0.027

    г)

    Мононенасыщенные жиры

    (

    0,025

    г)

    Имеют ли значение качество и разнообразие пыльцы?

    Abstract

    Колонии медоносных пчел сильно зависят от наличия цветочных ресурсов, из которых они получают питательные вещества (особенно пыльцу), необходимые для их развития и выживания.Однако в настоящее время на кормовых угодьях наблюдается интенсификация сельского хозяйства и изменение ландшафта. Таким образом, пчелы сталкиваются с неравенством во времени и пространстве в изобилии, типе и разнообразии растительных ресурсов, что может обеспечить неадекватное питание и подвергнуть опасности колонии. Благоприятное влияние наличия пыльцы на здоровье пчел хорошо известно, но остается неизвестным, могут ли качество и разнообразие рационов с пыльцой повлиять на здоровье пчел. Поэтому мы проверили влияние качества пыльцевого рациона (разная монофлорная пыльца) и разнообразия (полифлоральная пыльцевая диета) на физиологию молодых пчел-кормилиц, которые имеют отличную физиологию питания (например,грамм. развитие гипофарингеальной железы и уровень вителлогенина ), а также толерантность к паразиту микроспоридий Nosema ceranae путем измерения выживаемости пчел и активности различных ферментов, потенциально участвующих в здоровье и защитной реакции пчел (глутатион-S-трансфераза (детоксикация) ), фенолоксидаза (иммунитет) и щелочная фосфатаза (метаболизм)). Мы обнаружили, что качество пыльцы влияет на физиологию пчел-медсестер и на устойчивость к паразитам.Разнообразие пыльцевого рациона не влияло на физиологию пчел-кормилиц и выживаемость здоровых пчел. Однако при заражении паразитами пчелы, которых кормили полифлерной смесью, жили дольше, чем пчелы, которых кормили монофлерной пыльцой, за исключением монофлорной пыльцы, богатой белком. Кроме того, выживаемость положительно коррелировала с активностью щелочной фосфатазы у здоровых пчел и с активностью фенолоксидазы у инфицированных пчел. Наши результаты подтверждают идею о том, что как качество, так и разнообразие (в конкретном контексте) пыльцы могут влиять на физиологию пчел и могут помочь лучше понять влияние сельского хозяйства и интенсификации землепользования на питание и здоровье пчел.

    Образец цитирования: Di Pasquale G, Salignon M, Le Conte Y, Belzunces LP, Decourtye A, Kretzschmar A, et al. (2013) Влияние питания пыльцы на здоровье медоносных пчел: имеют ли значение качество и разнообразие пыльцы? PLoS ONE 8 (8): e72016. https://doi.org/10.1371/journal.pone.0072016

    Редактор: Йохен Зейл, Австралийский национальный университет, Австралия

    Поступила: 25 марта 2013 г .; Одобрена: 4 июля 2013 г .; Опубликовано: 5 августа 2013 г.

    Авторские права: © 2013 Di Pasquale et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Финансирование: Эта работа финансировалась за счет гранта Европейского фонда сельскохозяйственных гарантий (797/2004). ВВП был поддержан стипендией Conventions Industrielles de Formation par la REcherche (ANRT). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что конкурирующих интересов не существует.

    Введение

    Обеспечивая воспроизводство многих растений, опылители, такие как медоносные пчелы, необходимы для функционирования природных и сельскохозяйственных экосистем [1–3]. В свою очередь, опылители извлекают выгоду из этой услуги по опылению, собирая питательные вещества (нектар и пыльца), необходимые для их роста и здоровья. Например, у медоносных пчел цветочный нектар, содержащий углеводы и хранящийся в виде меда, является энергетическим топливом человека, а пыльца обеспечивает большую часть питательных веществ, необходимых для их физиологического развития [4].Таким образом, развитие и выживание семей медоносных пчел тесно связаны с доступностью этих питательных веществ в окружающей среде [4–6], что предполагает, что изменение районов кормления пчел из-за текущей интенсификации сельского хозяйства и изменений ландшафта может обеспечить недостаточное питание. и, следовательно, влияют на популяции медоносных пчел [7,8]. Это подтверждают и пчеловоды, которые считают плохое питание и голодание двумя основными причинами гибели колоний [9].Следовательно, изучение связи между доступностью питательных веществ и здоровьем пчел может помочь лучше понять текущие потери пчел, наблюдаемые во всем мире [10,11].

    Среди этих питательных веществ для цветов пыльца, которая фактически является основным источником белков, аминокислот, липидов, крахмала, стеролов, витаминов и минералов [12,13], является основным фактором, влияющим на продолжительность жизни людей [6]. Пыльца также важна на уровне колонии, поскольку она позволяет молодым рабочим производить студень, который используется для кормления личинок, маток, трутней и пожилых рабочих [14,15].Следовательно, прямым следствием недостаточности питания (нехватки пыльцы) является уменьшение популяции колонии [5] и, вероятно, ухудшение здоровья отдельных людей, что также может повлиять на порог устойчивости пчел к другим стрессам (патогенам или пестицидам) [8, 16]. Действительно, известно, что потребление пыльцы влияет на физиологический метаболизм [17,18], иммунитет [19], устойчивость к патогенам, таким как бактерии [20], вирус [21] и микроспоридии [22], а также снижает чувствительность к пестицидам [23]. .Однако медоносные пчелы редко сталкиваются с полным отсутствием пыльцы в окружающей их среде, а скорее сталкиваются с изменчивостью во времени и пространстве изобилия, типа и разнообразия ресурсов пыльцы. Кроме того, пыльца может различаться между видами цветов в отношении содержания питательных веществ [24–26], что позволяет предположить, что некоторые из них более полезны для пчел, чем другие. Следовательно, изучение влияния потребления пыльцы на здоровье пчел требует также учета качества и разнообразия пыльцевых рационов. Несмотря на то, что некоторые исследования показали, что качество пыльцы может влиять на продолжительность жизни пчел [27–30] и развитие гипофарингеальных желез [29,31], а в последнее время разнообразие пыльцы может улучшить некоторые иммунные функции [19], наши знания о влиянии Качество и разнообразие пыльцевых диет на здоровье пчел весьма ограничены.

    Чтобы улучшить наши знания по этой теме, было исследовано влияние качества и разнообразия пыльцевого рациона на физиологию медсестер и устойчивость к паразитам. Поскольку пыльца в основном потребляется молодыми пчелами-кормилицами, у них очень специфическая физиология питания с большими запасами липидов и белков (см. Обзоры в 32,33). Примечательно, что потребление пыльцы способствует развитию их гипофарингеальных желез, где переваренные питательные вещества пыльцы используются для производства студня, белкового секрета желез, который есть у сокамерников [14,15].Таким образом, физиология пчел-медсестер оценивалась путем определения развития гипофарингеальных желез, а также уровня экспрессии гена вителлогенина , который высоко экспрессируется у медсестер по сравнению с собирателями [34] и кодирует основной белок, продуцируемый в жировом теле и используется для производства студня [35]. Этот ген, который может регулироваться питанием [17,18], также замедляет старение [36] и участвует в регуляции клеточных иммунных функций [37]. Мы включили анализ гена трансферрина , белка транспорта железа, также продуцируемого в жировом теле и участвующего в развитии яичников [38-40] и иммунном ответе [41], например, вителлогенин .Однако неизвестно, регулируется ли он с точки зрения питания, что будет проверено в ходе этого исследования. Наконец, устойчивость к паразитизму была проверена с использованием широко распространенной микроспоридии Nosema ceranae , кишечного паразита, который может играть роль в потере колоний или ослаблении медоносных пчел [42–45]. С этой целью мы оценили влияние пыльцевой диеты и паразитов на выживаемость пчел и на физиологию путем измерения активности глутатион-S-трансферазы (GST), фенолоксидазы (PO) и щелочной фосфатазы (ALP).GST играют важную роль в детоксикации эндогенных и экзогенных соединений [46] и могут индуцироваться в кишечнике насекомых после бактериальной инфекции, что свидетельствует о защитной роли против патогенов [47]. Кроме того, предыдущие исследования показали более высокую активность GST после инфекции Nosema у пчел [48,49]. ПО играет важную роль в иммунитете насекомых, инкапсулируя патогены (например, бактерии и грибки) и восстанавливая ткани посредством меланогенеза [50], а ЩФ, участвующая во многих метаболических процессах, высоко экспрессируется в кишечнике насекомых и играет ключевую роль в здоровье кишечника у них. млекопитающие [51].

    Материалы и методы

    Состав пыльцы и факторы питания

    Влияние качества и разнообразия пыльцы было проверено путем кормления пчел монофлорными рационами, которые различались по питательным свойствам, или полифлерным рационом, состоящим из разных монофлорных пыльцевых пыльцев. Четыре смеси пыльцы полевых цветов с преобладанием пыльцы Cistus, Erica, Castanea и Rubus были закуплены свежими у Pollenergie® (Франция) и хранили при -20 ° C.Гранулы пыльцы собирали из пыльцевых ловушек у входа в улей. Рационы монофлорной пыльцы Cistus, Erica, Castanea и Rubus получали путем сортировки по цвету гранул преобладающей пыльцы из каждой смеси. Затем были проведены палинологические тесты для подтверждения рода каждой отсортированной пыльцы. Рацион полифлерной пыльцы состоял из смеси четырех монофлоральных пыльцевых частиц (25% каждой в зависимости от их веса).

    Чтобы оценить питательную ценность каждого рациона с пыльцой, мы проанализировали их содержание белка, аминокислот, липидов и сахара, а также их антиоксидантную способность.Содержание белка определяли микрокьельдалевым анализом (N x 6,25) с использованием Vapodest 45 (Gerhardt) и в соответствии с процедурой ISO 5983-2 [52]. Общие липиды анализировали после разрушения стенки пыльцы с помощью кислотного гидролиза соляной кислотой (HCl 6N). Затем липиды экстрагировали смесью хлороформ / метанол (2: 1, об. / Об.) По методу Folch et al. [53]. Содержание белка и липидов выражали в процентах от сухого вещества, которое определяли после сушки пыльцы в течение 24 ч при 75 ° C [54].Природу и концентрацию аминокислот определяли в 20 мг пыльцы методом ионообменной хроматографии с использованием автоматического анализатора аминокислот в соответствии с процедурой EC 152/2009 [55]. Использовали метод поглощения радикалов кислорода (ORAC) с AAPH (2,2’-азобис (2-амидинопропан) дигидрохлорид) в качестве генератора свободных радикалов, как описано Ou et al. [56], чтобы измерить антиоксидантную способность в 1 г каждой пыльцы. Антиоксидант тролокс использовался в качестве стандарта, поэтому данные выражены в эквиваленте тролокса.Для качественного измерения содержания сахара пыльцу обезвоживали в течение 48 часов при 35 ° C. Взвешивали 30 мг пыльцы и добавляли 1000 мкл воды сверхвысокого качества (18,2 мОм). Содержимое пропускали шприцем Hamilton через фильтр 0,2 мкм (Millex LG CI, 0,2 мкм; Millipore) и вводили в оборудование HPAEC Dionex ICS-3000. Разделение углеводов проводили на защитной колонке CarboPac PA-1 (4 x 50 мм) и анионообменной колонке CarboPac PA-1 (4 x 250 мм) после двукратного разбавления.Количественное определение углеводов проводили методом импульсной амперометрической детекции [57]. Присутствие остатков пестицидов в различных диетах пыльцы оценивали с помощью газовой и жидкостной хроматографии с пределом количественного определения 0,01 мг / кг и пределом обнаружения 0,005 мг / кг в соответствии с процедурой AFNOR 15662 [58] (Список проанализированных пестицидов в таблице S1).

    Выращивание и кормление пчел

    Для контроля поступления пыльцы эксперименты проводили на однодневных пчелах ( Apis mellifera ), выращиваемых в клетках (10.5 см x 7,5 см x 11,5 см). Соответствующие по возрасту пчелы были получены путем помещения сот, содержащих куколки на поздней стадии, в инкубатор при 34 ° C и влажности 50-70% и сбора пчел, появившихся в течение 10 часов. Они произошли из трех колоний и были смешаны перед помещением в клетки. Пчелам в клетках, содержащихся в инкубаторе (34 ° C и 50-70% влажности), давали ad libitum леденцы (Apifonda + сахарная пудра) и вода. Группы пчел получали один из следующих рационов с монофлорной пыльцой: Erica, Cistus, Rubus или Castanea , смесь четырех пыльцы (полифлорная диета) или не получали никакой пыльцы.Пыльцевые рационы готовили путем смешивания пыльцы с водой при массовом соотношении 10/1 (пыльца / вода), свежеприготовленные и заменяли каждый день в течение 7 дней. Чтобы предотвратить потенциальную компенсацию питательной ценности пчел, получавших одну из пыльцевых кормов, им не давали пыльцу ad libitum , а получали определенное количество пыльцы каждый день: 4 мг / пчела в первые два дня, 5 мг / пчела в следующие. два дня, 3 мг на пчелу на пятый день и 2 мг на пчелу в последние два дня. Эти количества были определены посредством предварительных экспериментов и представляют собой минимальное потребление всех пыльцы в день; и, как было обнаружено ранее, потребление пыльцы меняется с возрастом пчел (в первые дни увеличивается, а затем уменьшается) [4,31].Используя этот метод, пчелам давали одинаковое количество пыльцы для каждого рациона, и они потребляли все это каждый день. Поскольку некоторые пчелы погибли в течение периода кормления пыльцой (7 дней), количество пыльцы корректировалось каждый день в соответствии с количеством выживших пчел.

    Влияние качества и разнообразия пыльцы на физиологию медсестры

    Группы из 35 однодневных пчел были помещены в клетки и выращены в течение 7 дней с одной пыльцевой диетой. На 8 день их быстро замораживали в жидком азоте и хранили при -80 ° C для последующих физиологических анализов.Эксперимент повторяли 14 раз за один прием пыльцы.

    Развитие гипофарингеальных желез.

    Правая и левая железы в форме пяти пчел на клетку вскрывали на льду в 100 мкл физиологической сыворотки (0,9% NaCl). Обе железы были установлены на предметных стеклах и проанализированы под оптическим микроскопом, соединенным с камерой CF 11 DSP (Kappa). Развитие железы оценивали путем измерения максимального диаметра 15 случайно выбранных ацинусов на каждую железу ( n = 30 ацинусов на пчелу) [59] с помощью Saisam 5.Программное обеспечение 0.1 (Microvision®).

    Экспрессия гена брюшной полости.

    Брюшки 10 пчел на клетку гомогенизировали в 1 мл реагента Trizol (Invitrogen®) с TissueLyser (Qiagen®) (4 x 30 с при 30 Гц). Смесь инкубировали 5 мин при комнатной температуре и после центрифугирования (12000 g в течение 30 с при 4 ° C) 500 мкл супернатанта использовали для экстракции РНК. Добавляли сто мкл хлороформа (Sigma®), раствор инкубировали в течение 3 минут и центрифугировали (12000 g в течение 15 минут при 4 ° C).Водную фазу смешивали с равным объемом 70% этанола (Sigma®) и переносили в колонку Qiagen RNeasy. Экстракцию РНК проводили, как указано в наборе Qiagen RNeasy для общей РНК, с обработкой ДНКазой I на колонке (Qiagen®). Для синтеза кДНК 1000 нг РНК на образец подвергали обратной транскрипции с использованием набора High capacity RNA to cDNA Kit (Applied Biosystems). Образцы кДНК разводили в десять раз водой молекулярной чистоты.

    Уровень экспрессии вителлогенина и трансферрина определяли с помощью количественной ПЦР с использованием систем ПЦР в реальном времени StepOne-Plus (Applied Biosystems®) и метода обнаружения зеленого SYBR, включая пассивный эталонный краситель ROX.Три мкл кДНК смешивали с 5 мкл основной смеси SYBR Green PCR (Applied Biosystems®), 1 мкл прямого праймера (10 мкмоль) и 1 мкл обратного праймера (10 мкмоль) генов-кандидатов. Значения порога цикла (Ct) выбранных генов были нормализованы к гену домашнего хозяйства Actin с использованием метода сравнительной количественной оценки (метод дельта Ct). Последовательности праймеров (5’ – 3 ’): вителлогенин, вперед: TTGACCAAGACAAGCGGAACT, обратный: AAGGTTCGAATTAACGATGAA [60]; ген трансферрина : прямой: AGCGGCATACTCCAGGGAC, обратный: CGTTGAGCCTGATCCATACGA [61]; Актин вперед: TGCCAACACTGTCCTTTCTG, назад: AGAATTGACCCACCAATCCA.

    Влияние качества и разнообразия пыльцы на устойчивость пчел к

    Nosema ceranae

    Для эксперимента по толерантности пчел к Nosema ceranae , группы из 70 однодневных пчел были помещены в клетки и выращены в течение 7 дней с одной пыльцевой диетой. Для каждой диеты с пыльцой одна группа была инфицирована Nosema , а одна группа — Nosema -free, что дало 12 групп лечения. На 10 день 28 пчел на клетку мгновенно замораживали в жидком азоте и хранили при -20 ° C до анализа на глутатион-S-трансферазу, щелочную фосфатазу и фенолоксидазу.Остальные 42 пчелы были использованы для определения влияния пыльцевой диеты и Nosema ceranae на выживаемость пчел. Ежедневно подсчитывали мертвых пчел и удаляли их из клеток до тех пор, пока половина пчел не погибла. Эксперимент повторяли 9 раз для каждой группы лечения (пыльцевая диета, инфекция Nosema ).

    Заражение пчел
    Nosema ceranae .

    Споры Nosema были выделены из инфицированных колоний. Десять брюшков пчел-собирателей измельчали ​​в 2 мкл дистиллированной воды с помощью электрического измельчителя (Ultra Turrax® T18 basic, IKA®).Затем гомогенаты фильтровали через бумажный ватман № 4 и в фильтрат добавляли 10 мл дистиллированной воды. Растворы центрифугировали трижды при 800 g в течение 6 минут, и каждый раз осадок спор ресуспендировали в 10 мл дистиллированной воды. Идентификацию видов проводили, как в Alaux et al. [62], а концентрацию спор определяли с помощью гемоцитометра. Чтобы одинаково заразить пчел инокулятом Nosema ceranae , пчелам по отдельности скармливали 2 мкл свежеприготовленного 50% раствора сахарозы, содержащего 100 000 спор, который, как известно, вызывает инфекцию у рабочих пчел [63–65].Контрольных пчел кормили раствором сахарозы. В конце эксперимента кишечник пчел был проанализирован: у контрольных пчел споры обнаружены не были, но инфицированные пчелы были сильно паразитированы (данные не показаны).

    Ферментный анализ.

    Активность ферментов исследовали в различных тканях пчел: GST в кишечнике и голове, ALP в кишечнике и PO в брюшной полости без кишечника. Все анализы были выполнены на 3 пулах по 3 пчелы в клетке и в трех экземплярах. Образцы гомогенизировали при 4 ° C с помощью TissueLyser (Qiagen®) (5 × 10 с при 30 Гц) в буфере для экстракции (10 мМ NaCl, 1% (мас. / Об.) Triton X-100, 40 мМ фосфат натрия, pH 7.4, содержащий смесь 2 мг / мл антипаина, лейпептина и пепстатина А, 25 единиц / мл апротинина и 0,1 мг / мл ингибитора трипсина) в расчете на массу каждого пула (10% мас. / Об. Экстракта). Затем гомогенат центрифугировали при 4 ° C в течение 20 мин при 15000 g. Ферментативную активность в супернатанте анализировали в микропланшетах с помощью спектрофотометра BioTek Synergy HT100 (BioTek Instruments®). GST анализировали в реакционной среде (конечный объем 200 мкл), содержащей 10 мкл тканевого экстракта и 1 мМ EDTA, 2.5 мМ восстановленный глутатион, 1 мМ 1-хлор-2,4-динитробензол и 100 мМ Na / K-фосфат, pH 7,4. Активность GST отслеживали спектрофотометрически при 340 нм путем измерения конъюгации 1-хлор-2,4-динитробензола с восстановленным глутатионом в течение 5 минут при 25 ° C. ALP анализировали в реакционной среде (конечный объем 200 мкл), содержащей 10 мкл тканевого экстракта и 20 мМ MgCl 2 , 2 мМ p -нитрофенилфосфата в качестве субстрата и 100 мМ трис-HCl pH 8,5 [66]. Активность ALP отслеживали путем измерения гидролиза p -нитрофенилфосфата при 410 нм в течение 5 минут при 25 ° C.PO анализировали в реакционной среде (конечный объем 200 мкл), содержащей 50 мкл тканевого экстракта и 200 мМ NaCl, 0,4 мг / мл L-Dopa (3,4-дигидрокси-L-фенилаланин), 100 мМ фосфата натрия, pH. 7.2). Активность ПО отслеживали при 490 нм, измеряя превращение L-допа в меланин в течение 10 мин [62].

    Статистический анализ.

    Статистический анализ проводился с использованием статистической программы R [67]. Поскольку данные не были нормально распределены, влияние качества и разнообразия пыльцы на развитие гипофарингеальной железы, экспрессию вителлогенина и трансферрина и ферментативную активность было проанализировано с использованием множественных сравнительных тестов Краскела-Уоллиса и Данна.Чтобы проанализировать данные о выживаемости, полученные в течение 50 дней эксперимента, мы преобразовали данные в таблице выживаемости, и оставшиеся пчелы считались живыми на 50-й день. Следовательно, мы использовали регрессионную модель пропорциональных рисков Кокса с функциями R (coxph) и пакет [выживание] [68] для анализа влияния взаимодействия Nosema , пыльцы и пыльцы Nosema x на выживаемость пчел. Затем были протестированы эффекты Nosema для каждой пыльцевой диеты и влияние каждой пыльцы у непаразитированных пчел и Nosema пчел на выживаемость.Для пчел, не зараженных паразитами и Nosema , влияние рациона пыльцы на ферментативную активность определяли с использованием множественных сравнительных тестов Краскела-Уоллиса и Данна. Для каждой пыльцевой диеты влияние паразитизма Nosema на активность ферментов анализировали с использованием U-теста Манна-Уитни. Наконец, чтобы лучше понять основные механизмы долголетия пчел, мы оценили связь между LT50 (день, когда 50% пчел умерли в каждой клетке на основе исходных данных) и активностью ферментов (среднее значение из 3 проанализированных бассейнов на клетку) с использованием корреляции Спирмена для здоровых и паразитированных пчел.

    Результаты

    Факторы питания пыльцевой диеты

    Пищевая ценность каждой пыльцы была охарактеризована перед тестированием их воздействия на пчел (Таблица 1). Мы не обнаружили присутствие пестицидов в четырех пыльцах, входящих в состав различных рационов (Таблица S1). В отличие от липидов и сахаров, уровни белков, аминокислот и антиоксидантная способность сильно различались между пыльцой. Таким образом, пыльцевые рационы можно классифицировать по содержанию белка следующим образом (от самых бедных до самых богатых): Cistus , Erica , Mix (25% каждой пыльцы), Castanea и Rubus .Точно такая же тенденция была обнаружена при рассмотрении уровней аминокислот и антиоксидантов. Разница между Cistus и Rubus была особенно разительной, поскольку последний имел примерно в два раза больше белков и аминокислот и почти в пять раз большую антиоксидантную способность. Однако содержание липидов и сахара, которые не сильно различались, следовало разным образцам. Например, пыльца Erica была самой богатой липидами, но самой бедной по сахарам, и наоборот, пыльца Rubus .

    Пыльцевая диета Белки (%) Липиды (%) Сахара (%) Аминокислоты (г) µx 91 µx 900 Cistus 12 6,9 5,2 11,9 103
    Erica 14,8 7,4 4,8 16.27 196
    Castanea 21,6 6,6 5,0 18,68 399
    Рубус 22 6,4 6,4
    Mix 17,6 6,8 5,4 16,71 293

    Таблица 1. Содержание питательных факторов в различных пыльцах

    диет .

    Все корма для пыльцы содержали одни и те же аминокислоты, включая 10 незаменимых аминокислот, необходимых для развития взрослых пчел [69]: аргинин, гистидин, лизин, триптофан, фенилаланин, метионин, треонин, лейцин, изолейцин и валин (Таблица S2). Что касается содержания белка, большинство аминокислот было в меньших количествах в пыльце Cistus (особенно в 10 незаменимых аминокислотах) и в больших количествах в пыльце Rubus , тогда как пыльца Erica и Castanea имела промежуточные уровни.Только пролин был в максимальном количестве в пыльце Cistus .

    Что касается отдельных сахаров, во всех пыльцах были обнаружены только глюкоза и фруктоза (Таблица S3). Трегалоза, основной сахар гемолимфы пчел, присутствовала в пыльце Cistus и Castanea . Наконец, эрлоза была обнаружена только в пыльце Castanea, которая содержала все проанализированные сахара.

    Влияние качества и разнообразия пыльцы на физиологию пчел-кормилиц

    Пыльца изменила развитие гипофарингеальных желез (тест Краскела-Уоллиса, H = 143.84, p <0,001; Рисунок 1A), который был снижен у пчел, выращенных без пыльцы, но варьировался в зависимости от качества пыльцы, поскольку ацинусы были более развиты у пчел, получавших пыльцу Rubus , по сравнению с пчелами, получавшими пыльцу Cistus и Erica (Рисунок 1A). Развитие желез у пчел, получавших полифлерную смесь, не отличалось от пчел, получавших монофлерный рацион (139,5 ± 2,3 мкм), но почти равнялось среднему развитию желез, вызванному четырьмя рационами (137.5 ± 4,1 мкм).

    Рис. 1. Влияние качества и разнообразия пыльцы на физиологию медсестры.

    (A) Размер ацинусов гипофарингеальной железы, (B) уровни экспрессии вителлогенина и (C) тансферрина . Коробчатые диаграммы показаны для 5 и 10 пчел / повторность для желез и каждого гена, соответственно ( n = 14 повторностей, дающих рацион 70 и 140 пчел / пыльцу для желез и каждого гена, соответственно). Различные буквы указывают на существенные различия между диетами пыльцы ( p <0.05, множественные сравнительные тесты Краскала-Уоллиса и Данна). Прямоугольники показывают 1-й и 3-й межквартильный размах с линией, обозначающей медиану. Усы охватывают 90% особей, за пределами которых все выбросы представлены кружками.

    https://doi.org/10.1371/journal.pone.0072016.g001

    На уровень экспрессии вителлогенина и трансферрина значительно влияли различные рационы пыльцы ( вителлогенин : тест Крускала-Уоллиса, H = 43.13, p <0,001, фиг. 1B; трансферрин : тест Крускала-Уоллиса, H = 42,31, p <0,001, рисунок 1C), с более высокой экспрессией у пчел, которых кормили пыльцой, чем у пчел, которые не получали пыльцу (рисунок 1C). Интересно, что качество пыльцевой диеты также повлияло на экспрессию обоих генов, поскольку пыльца Erica и Rubus запускала наивысшую экспрессию вителлогенина и трансферрина (рис. 1B и C).Влияние полифлерной диеты не отличалось от влияния других диет ( вителлогенин, : 4,8 ± 0,3 и трансферрин, : 2,4 ± 0,3) и соответствовало среднему уровню экспрессии генов, индуцированному четырьмя монофлорными диетами ( вителлогенин : 4,6 ± 0,5 и трансферрин : 2,4 ± 0,5).

    Влияние качества и разнообразия пыльцы на устойчивость пчел к

    Nosema ceranae

    Nosema паразитизм и питание пыльцой уменьшали и увеличивали выживаемость пчел, соответственно (модель Кокса, p <0.001 для каждого фактора, рисунок 2). Эффект Nosema наблюдался независимо от типа рациона с пыльцой ( p <0,001 для каждого рациона с пыльцой, рисунок 2), и рационы с пыльцой изменяли выживаемость пчел независимо от воздействия Nosema (рисунок 2 и таблица 2) . Однако мы обнаружили значительную взаимосвязь между рационом Nosema и пыльцевой диетой ( p <0,001, рис. 2). За исключением пыльцы Cistus , качество и разнообразие пыльцевого рациона не влияли на выживаемость здоровых пчел, но имело значение, когда пчелы были заражены паразитами (Рисунок 2 и Таблица 2).Действительно, мы наблюдали значительное иерархическое влияние монофлерной пыльцы на выживаемость паразитированных пчел в следующем порядке от наименее к наиболее полезной пыльце: Cistus < Castanea < Erica < Rubus . Кроме того, пчелы, получавшие смесь полифлорной пыльцы, жили значительно дольше, чем пчелы, получавшие пыльцу Cistus , Erica и Castanea , но не было значительных различий с пчелами, получавшими пыльцу Rubus (Рисунок 2 и Таблица 2). .

    Рис. 2. Влияние пыльцевой диеты и инфекции Nosema ceranae на выживаемость пчел.

    Данные показывают процент выживаемости в течение 50 дней для (A) непаразитированных и (B) Nosema -паразитизированных пчел (9 повторов на пыльцевую диету). Разные буквы обозначают значительные различия между рационами пыльцы у непаразитизированных или паразитированных Nosema пчел ( p <0,05, модель регрессии пропорциональных рисков Кокса).

    https: // doi.org / 10.1371 / journal.pone.0072016.g002

    0001 09 90

    9909 9 0,00019 900

    Cistus Erica 16916 1693 9 19 9
    A
    Без пыльцы <0,0001 <0,0001 <0,0001 <0,0001 <0.0001
    Cistus <0,0001 <0,0001 <0,0001 <0,0001
    Erica 0,47 0,125 0,47 0,47 0,36 0,84
    Рубус 0,47
    B 31966
    <0,0001 <0,0001 <0,0001 <0,0001
    Cistus <0,0001 <0,0001 <0,0001
    <0,0001 0,047 0,007
    Castanea <0,0001 <0,0001

    Rubus

    42

    Таблица 2. Сравнительное влияние кормления пыльцой на выживаемость (А) непаразитированных пчел и (В) Nosema -паразитированных пчел.

    Если посмотреть на физиологию пчелы, Nosema не повлиял на активность GST в кишечнике (рис. 3А). Тем не менее, пыльцевый рацион изменил уровень GST как у здоровых, так и у паразитированных пчел (тест Краскала-Уоллиса, H = 35,73, p <0,001 и тест Краскела-Уоллиса, H = 32,73, p <0.001, соответственно, фиг. 3A), а самая высокая активность наблюдалась с пыльцевой диетой Erica (фиг. 3A). В голове активность GST была значительно ниже у пчел, инфицированных Nosema (рис. 3B), но была выше у пчел, которых кормили пыльцой, независимо от воздействия Nosema (тест Краскала-Уоллиса, H = 22,06, p ). <0,001 и критерий Краскела-Уоллиса, H = 27,28, p <0,001, соответственно, рисунок 3B). В отличие от того, что наблюдалось в кишечнике, тип пыльцевой диеты не влиял на уровень GST в голове.

    Рисунок 3. Влияние пыльцевой диеты и инфекции Nosema ceranae на глутатион-S-трансферазу.

    Активность фермента оценивали в (A) кишечнике и (B) головах пчел. Коробчатые диаграммы показаны для 3 пулов по 3 пчелы / повторность ( n = 9 повторностей, что дает 81 пчелу всего / рацион пыльцы). Разные буквы обозначают значительные различия между рационами пыльцы у непаразитированных (белые прямоугольники) или Nosema -паразитизированных пчел (серые прямоугольники) ( p <0.05, множественные сравнительные тесты Краскала-Уоллиса и Данна) и * указывают на значительные различия между паразитированными и непаразитированными пчелами для каждой пыльцевой диеты ( p <0,05, U-критерий Манна-Уитни). Прямоугольники показывают 1-й и 3-й межквартильный размах с линией, обозначающей медиану. Усы охватывают 90% особей, за пределами которых все выбросы представлены кружками.

    https://doi.org/10.1371/journal.pone.0072016.g003

    Nosema ceranae вызывало снижение активности ЩФ вне зависимости от рациона пыльцы (рис. 4).Однако, помимо более высокой активности, индуцированной пыльцой Castanea по сравнению с пыльцой Cistus у здоровых пчел, качество и разнообразие поставляемой пыльцы не влияли на активность ЩФ в кишечнике пчел (здоровые пчелы: тест Краскала-Уоллиса, H = 14,29, p = 0,013 и паразитированные пчелы: тест Крускала-Уоллиса, H = 12,54, p = 0,028, рисунок 4).

    Рисунок 4. Влияние пыльцевой диеты и инфекции Nosema ceranae на щелочную фосфатазу кишечника.

    Коробчатые диаграммы показаны для 3 пулов по 3 пчелы / повтор ( n = 9 повторностей, что дает 81 пчелу всего / рацион пыльцы). Разные буквы обозначают существенные различия между диетами пыльцы у непаразитизированных (белые прямоугольники) или Nosema -паразитизированных пчел (серые прямоугольные диаграммы) ( p <0,05, множественные сравнительные тесты Краскела-Уоллиса и Данна), а * указывает на значимые различия между паразитированными и непаразитированными пчелами для каждой пыльцевой диеты ( p <0.05, U-тесты Манна-Уитни). Прямоугольники показывают 1-й и 3-й межквартильный размах с линией, обозначающей медиану. Усы охватывают 90% особей, за пределами которых все выбросы представлены кружками.

    https://doi.org/10.1371/journal.pone.0072016.g004

    Nosema ceranae вызвала значительное повышение активности ПО у пчел, лишенных пыльцы (Рисунок 5). У инфицированных пчел активность иммунных ферментов была ниже в присутствии пыльцы, за исключением Erica (тест Краскела-Уоллиса, H = 49.64, p <0,001, рисунок 5). У здоровых пчел потребление пыльцы имело ограниченное влияние на активность ПО (тест Краскала-Уоллиса, H = 19,24, p <0,001, рисунок 5). Только пыльца Erica показала значительно более высокую активность по сравнению с пыльцой Castanea и Rubus .

    Рисунок 5. Влияние пыльцевой диеты и инфекции Nosema ceranae на фенолоксидазу.

    Коробчатые диаграммы показаны для 3 пулов по 3 пчелы / повтор ( n = 9 повторностей, что дает 81 пчелу всего / рацион пыльцы).Разные буквы обозначают существенные различия между диетами пыльцы у непаразитизированных (белые прямоугольники) или Nosema -паразитизированных пчел (серые прямоугольные диаграммы) ( p <0,05, множественные сравнительные тесты Краскела-Уоллиса и Данна), а * указывает на значимые различия между паразитированными и непаразитированными пчелами для каждой пыльцевой диеты ( p <0,05, U-критерий Манна-Уитни). Прямоугольники показывают 1-й и 3-й межквартильный размах с линией, обозначающей медиану. Усы охватывают 90% особей, за пределами которых все выбросы представлены кружками.

    https://doi.org/10.1371/journal.pone.0072016.g005

    Наконец, мы определили, связан ли LT50 пчел с активностью различных исследованных ферментов. У здоровых пчел продолжительность жизни положительно коррелировала с активностью ЩФ (т.е.активность ЩФ объясняла 50% продолжительности жизни пчел), но когда пчелы были инфицированы Nosema , продолжительность жизни была положительно связана с активностью ПО (Рисунок 6).

    Обсуждение

    Результаты этого исследования подтверждают идею о том, что питательные качества и разнообразие питания пыльцы могут влиять на здоровье пчел.Действительно, мы обнаружили, что и физиология пчел, и их толерантность к паразитам варьировались в зависимости от типа пыльцевого рациона, что позволяет предположить, что не только доступность, но и качество ресурсов окружающей среды имеют значение.

    Тип пыльцы, предоставленной пчелам, оказал значительное влияние на физиологию пчел-кормилиц. Пчелы, которых кормили пыльцой, богатой белком ( Rubus ), показали наиболее развитые ацинусы и самый высокий уровень экспрессии вителлогенина и трансферрина .Это имеет тенденцию подтверждать предыдущие исследования, которые показали, что развитие гипофарингеальной железы связано с уровнем белков в пище [29,31]. Однако другие рационы с пыльцой не вызывали значительного развития различных желез, что можно объяснить слишком маленьким диапазоном содержания белка и / или других факторов питания. Питание пыльцой также увеличивало экспрессию вителлогенина и трансферрина . Поскольку оба гена экспрессируются в жировых телах, основном месте хранения питательных веществ, а пыльца способствует развитию жировых тел [19], разумно ожидать увеличения уровней экспрессии обоих генов, как было ранее обнаружено для вителлогенина после потребление белков [70].Однако экспрессия вителлогенина и трансферрина у пчел, получавших пыльцу Erica , не отличалась от экспрессии пчел, получавших пыльцу Rubus , хотя Erica содержал меньшее количество белков. Это говорит о том, что их экспрессия чувствительна не только к уровню белка, но и к другим факторам питания. При рассмотрении факторов питания мы обнаружили, что пыльца Erica имеет самое высокое содержание липидов, что могло способствовать увеличению жировых тел и, следовательно, экспрессии обоих генов, поскольку жировые ткани также являются основным местом метаболизма липидов. (е.грамм. синтез жирных кислот и производство триацилглицеридов) [71]. Эта потенциальная роль липидов в синтезе вителлогенина дополнительно подтверждает, что они важны для физиологии медсестры [72] и производства расплода [73]. Кроме того, интересно отметить, что вителлогенин и трансферрин имели сходные паттерны экспрессии в соответствии с различными диетами пыльцы. Эта ковариация в экспрессии генов была также обнаружена в предыдущих работах по изучению потенциальной роли этих генов в развитии яичников [38,39].

    Качество пыльцы также влияет на устойчивость пчел к паразитам ( Nosema ceranae ). Как и ожидалось, заражение Nosema уменьшило выживаемость пчел [49,64], а питание пыльцой увеличило выживаемость как здоровых, так и зараженных паразитами пчел. За исключением пчел, которых кормили пыльцой с самым низким содержанием белка ( Cistus ), мы не наблюдали разницы в выживаемости между разными диетами пыльцы, когда пчелы не были паразитированы. Однако качество пыльцы имело сильное влияние, когда пчелы заражались микроспоридиями; выживаемость пчел значительно различалась между четырьмя различными монофлерными диетами (от наименее полезной пыльцы до наиболее полезной: Cistus < Castanea < Erica < Rubus ).Это говорит о том, что качество питательных веществ пыльцы может не иметь или иметь ограниченное влияние на физиологию здоровых пчел, но может повлиять на их способность переносить внешний стресс, такой как паразиты. Положительное влияние пыльцы Rubus по сравнению с пыльцой Cistus также было доказано при изучении влияния качества рациона на вес личинок шмелей [74]. Чрезвычайно высокий уровень белка и антиоксидантов пыльцы Rubus по сравнению с пыльцой Cistus может объяснить более высокую выживаемость инфицированных пчел, которых кормили пыльцой, полученной ранее.В частности, известно, что белки улучшают выживаемость пчел (см. 4 обзор). Высокий уровень аминокислот также может играть важную роль, поскольку десять из них необходимы пчелам в определенных концентрациях [69]. Однако иерархическое влияние монофлорной диеты не было связано с уровнями белков, аминокислот или антиоксидантов, например пчелы, получавшие пыльцу Erica (14,8% белка), жили дольше, чем пчелы, получавшие пыльцу Castanea (21,6% белка). Пыльца Erica фактически имела самое высокое содержание липидов и способствовала более высокому производству вителлогенина , чем пыльца Castanea (Рисунок 1B).Положительное влияние вителлогенина на продолжительность жизни пчел [36] может способствовать увеличению выживаемости паразитированных пчел, снабженных пыльцой Erica . Это говорит о том, что качество пыльцы следует оценивать не на основе одного или нескольких факторов питания, а на основе всех факторов питания в целом.

    Что касается защитного механизма, общая активность GST (детоксикация), ALP и PO (иммунитет) также изменилась в соответствии с диетами пыльцы, но мы не наблюдали закономерности, аналогичной выживаемости пчел.Поэтому было невозможно связать влияние качества рациона на выживаемость пчел с уровнем активности этих ферментов. Более того, паттерны активности ферментов не были изменены инфекцией Nosema , но общий уровень головного GST и ALP был снижен, что подтверждает предыдущее исследование [49]. Однако ранее сообщалось о повышении активности GST в кишечнике пчел, зараженных паразитом Nosema [48,49], что, вероятно, защищает хозяина от окислительного стресса, вызванного паразитом [47].Отсутствие ответа GST в нашем исследовании могло быть связано с диетой, поскольку мы не использовали коммерческую смесь белков, аминокислот и витаминов, как в обоих предыдущих исследованиях, что могло способствовать ответу GST. Интересно, что профиль активности GST в кишечнике был очень похож на профиль экспрессии вителлогенина и трансферрина в соответствии с различными диетами, причем пыльца Erica и Rubus давала наивысшую активность. Однако ничего не известно о связи между GST и этими двумя генами.Что касается активности ПО, то у других насекомых хорошо известно, что на уровень ПО может влиять качество рациона [75–77]. В самом деле, меланогенез, регулируемый ПО через синтез меланина (богатого азотом хинонового полимера), может быть дорогостоящим в азоте [78] и, таким образом, чувствителен к изменениям в ресурсах азота. Тем не менее, в предыдущем исследовании [19] он не отличался между диетами с пыльцой, а в нашем исследовании он был выше только с пыльцой Erica . Следовательно, необходимы дальнейшие исследования, чтобы лучше понять взаимосвязь между пыльцевым питанием и активностью ПО у пчел.

    Диетическое разнообразие пыльцы не было связано с улучшением физиологии медсестер, что отражено измеренными физиологическими параметрами. Влияние полифлерной диеты фактически сводилось к среднему значению влияния каждой монофлорной пыльцы. Это говорит о том, что высококачественная монофлоральная пыльца может быть лучше, чем смесь более низкого питательного качества, как при выращивании расплода [79,80]. Однако вполне вероятно, что пыльцевый рацион пчел не влияет на различные физиологические факторы пчел в равной степени.Это наблюдалось в недавнем исследовании, показывающем более высокую активность глюкозооксидазы у пчел, которых кормили смесью полифлорной пыльцы, по сравнению с монофлорной пыльцой, но на активность ПО и количество гемоцитов полифлорная диета не влияла [19]. Это дополнительно подтверждается нашим исследованием, поскольку полифлоровая смесь положительно влияла на выживаемость паразитированных пчел. Он не соответствовал среднему значению для каждого эффекта пыльцы, но был выше, чем пыльца Cistus, Castanea и Erica , и на том же уровне, чем пыльца Rubus .Эта тенденция не наблюдалась у здоровых пчел, что еще раз указывает на то, что качество питания может значительно влиять на восприимчивость людей к паразитам. Неизвестно, было ли увеличение выживаемости пчел, которых кормили полифлорной смесью, результатом комбинации четырех пыльцы или простого присутствия пыльцы Rubus , хотя она содержала четверть этой пыльцы. Аналогичные результаты были получены Foley et al. [81], которые наблюдали снижение восприимчивости к грибковому паразиту Aspergillus личинок пчел, которых кормили определенной пыльцой или смесью.

    Наконец, чтобы расшифровать некоторые физиологические механизмы, лежащие в основе здоровья пчел, мы определили, связана ли активность GST, PO и ALP с увеличением выживаемости у здоровых или паразитированных пчел. Выживание было положительно связано с активностью ALP и PO у здоровых и инфицированных Nosema пчел, соответственно. У млекопитающих ЩФ участвует в регуляции всасывания питательных веществ (особенно липидов), детоксикации бактериальных липополисахаридов, толерантности кишечника к комменсальным бактериям, предотвращает бактериальную инвазию и уменьшает воспаление кишечника, играя, таким образом, ключевую роль в здоровье кишечника (см. 51 обзор ).Неизвестно, выполняет ли ALP сходные роли у насекомых, но существуют структурные и функциональные гомологии между ALP насекомых и млекопитающих [82]. Кроме того, корреляция между активностью ЩФ и выживаемостью пчел предполагает, что этот фермент может иметь важное значение для здоровья насекомых. Когда его активность снизилась из-за инфекции Nosema , она больше не была связана с выживаемостью пчел. В этом случае выживаемость была связана с активностью ПО. Однако, за исключением отсутствия пыльцы, у паразитированных пчел не наблюдался иммунный ответ на ПО, что подтверждает идею о том, что выживаемость пчел просто связана с более высокой базальной активностью ПО.

    В заключение, пыльца неодинакова по своему влиянию на здоровье пчел, и полифлорная смесь не обязательно лучше, чем монофлорная пыльца с хорошей питательной ценностью (например, пыльца Rubus ). Однако, когда пчелы заражены ( N . Ceranae здесь), наличие различных цветочных ресурсов может покрыть ограниченное влияние некоторых пыльцы и повысить устойчивость к инфекции до уровня богатой пыльцы. Ареалы опыления пчел в настоящее время меняются из-за интенсификации сельского хозяйства и изменения ландшафта, и пчелы часто сталкиваются с уменьшением доступности и разнообразия ресурсов во времени и пространстве.Ожидается, что глобальное изменение климата также изменит экологические ресурсы пчел из-за изменений в фенологии и распространении растений [83]. Следовательно, поддержание и / или развитие растительных ресурсов в агроэкосистемах необходимо для предотвращения негативного воздействия деятельности человека и поддержания популяции пчел [7].

    Благодарности

    Авторы хотели бы поблагодарить М. Кузена и Г. Роде за их помощь в вскрытии пчел, М. Шарбонье за ​​помощь с редактированием на английском языке и рецензентов за комментарии, которые значительно улучшили рукопись.

    Вклад авторов

    Задумал и спроектировал эксперименты: GDP YLC LPB AD CA. Проведены эксперименты: GDP MS SS CA. Проанализированы данные: ВВП АК JLB CA. Предоставленные реагенты / материалы / инструменты анализа: YLC LPB AD. Написал рукопись: GDP CA.

    Ссылки

    1. 1. Klein AM, Vaissière BE, Cane JH, Steffan-Dewenter I, Cunningham SA et al. (2007) Важность опылителей в изменении ландшафтов мировых культур. Proc R Soc Lond B 274: 303-313.DOI: https: //doi.org/10.1098/rspb.2006.3721. PubMed: 17164193.
    2. 2. Gallai N, Salles JM, Settele J, Vaissiere BE (2009) Экономическая оценка уязвимости мирового сельского хозяйства в условиях сокращения количества опылителей. Ecol Econ 68: 810-821. DOI: https: //doi.org/10.1016/j.ecolecon.2008.06.014.
    3. 3. Морс Р.А. (1991) Пчелы навсегда. Тенденции Ecol Evol 6: 337-338. DOI: https: //doi.org/10.1016/0169-5347 (91)

      -W. PubMed: 21232501.
    4. 4. Brodschneider R, Crailsheim K (2010) Питание и здоровье медоносных пчел.Apidologie 41: 278-294. DOI: https: //doi.org/10.1051/apido/2010012.
    5. 5. Келлер I, Флури П., Имдорф А. (2005) Питание пыльцой и развитие колоний у медоносных пчел, Часть II. Пчелиный мир 86: 27-34.
    6. 6. Хайдак М.Х. (1970) Медоносное питание пчел. Анну Преподобный Энтомол 15: 143-156. DOI: https: //doi.org/10.1146/annurev.en.15.010170.001043.
    7. 7. Decourtye A, Mader E, Desneux N (2010) Улучшение ландшафта цветочных ресурсов для медоносных пчел в агроэкосистемах.Apidologie 41: 264-277. DOI: https: //doi.org/10.1051/apido/2010024.
    8. 8. Науг Д. (2009) Стресс, связанный с питанием из-за потери среды обитания, может объяснить недавний коллапс пчелиной семьи. Биол Консерв 142: 2369-2372. DOI: https://doi.org/10.1016/j.biocon.2009.04.007.
    9. 9. Ван Энгельсдорп Д., Хейс мл., Андервуд Р. М., Петтис Дж. (2008) Обзор потерь колоний медоносных пчел в США с осени 2007 по весну 2008. PLOS ONE 3: e4071. DOI: https: //doi.org/10.1371/journal.pone.0004071.PubMed: 115.
    10. 10. Нойманн П., Каррек Н.Л. (2010) Потери пчелиных семей. J Apicult Res 49: 1-6. DOI: https: //doi.org/10.3896/IBRA.1.49.1.01.
    11. 11. Ван Энгельсдорп Д., Мейкснер доктор медицины (2010) Исторический обзор управляемых популяций медоносных пчел в Европе и США и факторов, которые могут на них повлиять. J Invertebr Pathol 103: S80-S95. DOI: https: //doi.org/10.1016/j.jip.2009.06.011. PubMed: 193.
    12. 12. Roulston TH, Buchmann SL (2000) Филогенетический пересмотр корреляции пыльцевого крахмала и опыления.Evol Ecol Res 2: 627-643.
    13. 13. Стэнли Р.Г., Линскенс Х.Ф. (1974) Пыльца: биология, биохимия, менеджмент. Гейдельберг, Германия: Springer Verlag.
    14. 14. Crailsheim K, Schneider LHW, Hrassnigg N, Bühlmann G, Brosch U et al. (1992) Потребление и использование пыльцы рабочими пчелами (Apis mellifera carnica): зависимость от возраста и функций человека. J. Insect Physiol 38: 409-419. DOI: https: //doi.org/10.1016/0022-1910 (92)

      -V.
    15. 15. Crailsheim K (1992) Поток студня в колонии медоносных пчел. J. Comp Physiol B 162: 681-689.DOI: https: //doi.org/10.1007/BF00301617.
    16. 16. Le Conte Y, Brunet J-L, McDonnell C, Dussaubat C, Alaux C (2011) Взаимодействие между факторами риска у медоносных пчел. В: D. SammataroJ. Йодер. Недавние исследования проблем с нашими опылителями меда пчелами. Taylor & Francis Inc., стр. 215–222.
    17. 17. Alaux C, Dantec C, Parrinello H, Le Conte Y (2011) Нутригеномика у медоносных пчел: цифровой анализ экспрессии генов питательных эффектов пыльцы на здоровых пчелах и пчелах, зараженных варроа.BMC Genomics 12: 496. DOI: https: //doi.org/10.1186/1471-2164-12-496. PubMed: 21985689.
    18. 18. Амент С.А., Чан К.В., Уиллер М.М., Никсон С.Е., Джонсон С.П. и др. (2011) Механизмы стабильной потери липидов у социальных насекомых. J Exp Biol 214: 3808-3821. DOI: https://doi.org/10.1242/jeb.060244. PubMed: 22031746.
    19. 19. Alaux C, Ducloz F, Crauser D, Le Conte Y (2010) Влияние диеты на иммунокомпетентность медоносных пчел. Biol Lett 6: 562-565. DOI: https: //doi.org/10.1098/rsbl.2009.0986. PubMed: 20089536.
    20. 20. Риндерер Т.Е., Ротенбюлер В.К., Гохнауэр Т.А. (1974) Влияние пыльцы на восприимчивость личинок медоносных пчел к личинкам Bacillus . J Invertebr Pathol 23: 347-350. DOI: https: //doi.org/10.1016/0022-2011 (74)

      -1. PubMed: 4833177.

    21. 21. Degrandi-Hoffman G, Chen Y, Huang E, Huang MH (2010) Влияние диеты на концентрацию белка, развитие гипофарингеальных желез и вирусную нагрузку у рабочих медоносных пчел ( Apis mellifera L.). J. Физиология насекомых 56: 1184-1191. DOI: https: //doi.org/10.1016/j.jinsphys.2010.03.017. PubMed: 20346950.
    22. 22. Риндерер Т.Э., Эллиотт К.Д. (1977) Реакция рабочих медоносных пчел на инфекцию Nosema apis . J Econ Entomol 70: 431-433.
    23. 23. Wahl O, Ulm K (1983) Влияние кормления пыльцой и физиологического состояния на чувствительность медоносной пчелы к пестицидам Apis mellifera carnica . Oecologia 59: 106-128. DOI: https://doi.org/10.1007/BF00388082.
    24. 24. Roulston TH, Cane JH (2000) Пищевая ценность и усвояемость пыльцы для животных. Plant Syst Evol 222: 187-209. DOI: https: //doi.org/10.1007/BF00984102.
    25. 25. Герберт Э. У. мл., Шимануки Х. (1978) Химический состав и питательная ценность пыльцы, собранной и хранимой пчелами. Апидология 9: 33-40. DOI: https: //doi.org/10.1051/apido: 19780103.
    26. 26. Odoux JF, Feuillet D, Aupinel P, Loublier Y, Tasei JN et al. (2012) Территориальное биоразнообразие и его влияние на физико-химические характеристики пыльцы, собираемой семьями медоносных пчел.Apidologie 43: 561-575. DOI: https: //doi.org/10.1007/s13592-012-0125-1.
    27. 27. Schmidt JO, Thoenes SC, Levin MD (1987) Выживание медоносных пчел, Apis mellifera (Hymenoptera: Apidae), питавшихся различными источниками пыльцы. J Econ Entomol 80: 176-183.
    28. 28. Schmidt LS, Schmidt JO, Rao H, Wang W, Xu L (1995) Предпочтение кормления и выживаемость молодых рабочих медоносных пчел (Hymenoptera: Apidae), которых кормили рапсом, кунжутом и пыльцой подсолнечника. J Econ Entomol 88: 1591-1595.
    29. 29. Standifer LN (1967) Сравнение качества белка пыльцы для стимуляции роста гипофарингеальных желез и долголетия медоносных пчел, Apis mellifera L. (Hymenoptera: Apidae). Насекомые Soc 14: 415-426. DOI: https: //doi.org/10.1007/BF02223687.
    30. 30. Маурицио А. (1950) Влияние кормления пыльцой и выращивания расплода на продолжительность жизни и физиологическое состояние медоносной пчелы. Пчелиный мир 31: 9-12.
    31. 31.Pernal SF, Currie RW (2000) Качество пыльцы свежих и однолетних рационов с одной пыльцой для рабочих медоносных пчел ( Apis mellifera L.). Apidologie 31: 387-409. DOI: https: //doi.org/10.1051/apido: 2000130.
    32. 32. Амдам Г. В., Пейдж RE (2010) Генетика развития и физиология пчелиных сообществ. Анимационное поведение 79: 973-980. DOI: https: //doi.org/10.1016/j.anbehav.2010.02.007. PubMed: 20514137.
    33. 33. Ament SA, Wang Y, Robinson GE (2010) Регулирование питания при разделении труда у медоносных пчел: к перспективе системной биологии.Wiley Interdiscip. Rev Syst Biol Med 2: 566-576.
    34. 34. Amdam GV, Norberg K, Fondrk MK, Page RE Jr. (2004) Репродуктивный план земли может опосредовать эффекты отбора на уровне колонии на индивидуальное поведение медоносных пчел при кормлении. Proc Natl Acad Sci U S A 101: 11350-11355. DOI: https: //doi.org/10.1073/pnas.0403073101. PubMed: 15277665.
    35. 35. Амдам Г. В., Норберг К., Хаген А., Омхольт С. В. (2003) Социальная эксплуатация вителлогенина. Proc Natl Acad Sci U S A 100: 1799–1802.DOI: https: //doi.org/10.1073/pnas.0333979100. PubMed: 12566563.
    36. 36. Seehuus SC, Norberg K, Gimsa U, Krekling T, Amdam GV (2006) Репродуктивный белок защищает функционально стерильных рабочих медоносных пчел от окислительного стресса. Proc Natl Acad Sci U S A 103: 962-967. DOI: https: //doi.org/10.1073/pnas.0502681103. PubMed: 16418279.
    37. 37. Амдам Г.В., Симоэс ЗЛП, Хаген А., Норберг К., Шредер К. и др. (2004) Гормональный контроль предшественника желтка, вителлогенина, регулирует иммунную функцию и продолжительность жизни медоносных пчел.Эксп. Геронтол 39: 767-773. DOI: https: //doi.org/10.1016/j.exger.2004.02.010. PubMed: 15130671.
    38. 38. Koywiwattrakul P, Sittipraneed S (2009) Экспрессия вителлогенина и трансферрина в активированных яичниках рабочих медоносных пчел, Apis mellifera . Biochem Genet 47: 19-26. DOI: https: //doi.org/10.1007/s10528-008-9202-6. PubMed: 128.
    39. 39. Koywiwattrakul P, Thompson GJ, Sitthipraneed S, Oldroyd BP, Maleszka R (2005) Влияние наркоза углекислым газом на активацию яичников и экспрессию генов у рабочих медоносных пчел, Apis mellifera .J Insect Sci 5: 36. PubMed: 17119618.
    40. 40. Нино Е.Л., Тарпи Д.Р., Грозингер С.М. (2013) Дифференциальное влияние объема осеменения и вещества на репродуктивные изменения маток медоносных пчел ( Apis mellifera L.). Насекомое Mol Biol.
    41. 41. Kucharski R, Maleszka R (2003) Транскрипционное профилирование выявляет многофункциональные роли трансферрина у медоносной пчелы, Apis mellifera . J Insect Sci 3: 27. PubMed: 15841243.
    42. 42. Хигес М., Меана А., Бартоломе С., Ботиас С., Мартин-Эрнандес Р. (2013) Nosema ceranae (Microsporidia), спорный патоген медоносных пчел 21 века.Environ Microbiol Rep 5: 17-29. DOI: https://doi.org/10.1111/1758-2229.12024. PubMed: 23757127.
    43. 43. Fries I (2010) Nosema ceranae у европейских медоносных пчел ( Apis mellifera ). J Invertebr Pathol 103: S73-S79. DOI: https: //doi.org/10.1016/j.jip.2009.06.017. PubMed: 197.
    44. 44. Хигес М., Мартин-Эрнандес Р., Меана А (2010) Nosema ceranae в Европе: эмерджентный ноземоз типа C. Apidologie 41: 375-392. doi: https: // doi.org / 10.1051 / apido / 2010019.
    45. 45. Paxton RJ (2010) Вызывает ли инфекция Nosema ceranae «расстройство коллапса колонии» у медоносных пчел ( Apis mellifera )? J Apicult Res 49: 80-84. DOI: https: //doi.org/10.3896/IBRA.1.49.1.11.
    46. 46. Sies H (1997) Окислительный стресс: оксиданты и антиоксиданты. Exp Physiol 82: 291-295. PubMed:

      43.
    47. 47. Buchon N, Broderick NA, Poidevin M, Pradervand S, Lemaitre B (2009) Кишечный ответ дрозофилы на бактериальную инфекцию: активация защиты хозяина и пролиферация стволовых клеток.Клеточный микроб-хозяин 5: 200-211. DOI: https://doi.org/10.1016/j.chom.2009.01.003. PubMed: 190.
    48. 48. Vidau C, Diogon M, Aufauvre J, Fontbonne R, Viguès B et al. (2011) Воздействие сублетальных доз фипронила и тиаклоприда значительно увеличивает смертность медоносных пчел, ранее инфицированных Nosema ceranae . PLOS ONE 6: e21550. DOI: https: //doi.org/10.1371/journal.pone.0021550. PubMed: 21738706.
    49. 49. Dussaubat C, Brunet JL, Higes M, Colbourne JK, Lopez J et al.(2012) Патология кишечника и реакция на Microsporidium Nosema ceranae у медоносной пчелы Apis mellifera . PLOS ONE 7: e37017. DOI: https: //doi.org/10.1371/journal.pone.0037017. PubMed: 22623972.
    50. 50. González-Santoyo I, Córdoba-Aguilar A (2012) Фенолоксидаза: ключевой компонент иммунной системы насекомых. Entomol Exp Appl 142: 1-16. DOI: https: //doi.org/10.1111/j.1570-7458.2011.01187.x.
    51. 51. Lallès JP (2010) Щелочная фосфатаза кишечника: многочисленные биологические роли в поддержании гомеостаза кишечника и модуляции диетой.Nutr Rev 68: 323-332. DOI: https: //doi.org/10.1111/j.1753-4887.2010.00292.x. PubMed: 20536777.
    52. 52. ISO 5983 (1997) Корма для животных. Определение содержания азота и расчет содержания сырого протеина — метод Кьельдаля. Швейцария, Женева: Международная организация по стандартизации.
    53. 53. Folch J, Lees M, Sloane Stanley GH (1957) Простой метод выделения и очистки общих липидов из тканей животных. J Biol Chem 226: 497-509.PubMed: 13428781.
    54. 54. Louveaux J (1959) Recherches sur la récolte du pollen par les abeilles ( Apis mellifera L.). Annales De L’abeille 2: 99
    55. 55. Постановление Комиссии (ЕС) № 152/2009 от 27 января 2009 г., устанавливающее методы отбора проб и анализа для официального контроля кормов. Официальный журнал Eur Union L 54 (26 февраля 2009 г.): 23–37.
    56. 56. Оу Б., Хэмпш-Вудилл М., Прайор Р.Л. (2001) Разработка и валидация улучшенного анализа абсорбционной способности кислородных радикалов с использованием флуоресцеина в качестве флуоресцентного зонда.J. Agric Food Chem., 49: 4619-4626. DOI: https: //doi.org/10.1021/jf010586o. PubMed: 11599998.
    57. 57. Baude M, Leloup J, Suchail S, Allard B, Benest D et al. (2011) Подстилка и взаимодействие растений влияют на содержание сахара в нектаре. Дж. Экол 99: 828-837. DOI: https: //doi.org/10.1111/j.1365-2745.2011.01793.x.
    58. 58. AFNOR 15662 (2009) Пищевые продукты растительного происхождения: универсальный метод определения остатков пестицидов с помощью ГХ-МС и SL / SM / MS экстракции / разделения с ацетонитрилом и очистки диспергированным SPE.
    59. 59. Crailsheim K, Stolberg E (1989) Влияние диеты, возраста и состояния колоний на протеолитическую активность кишечника и размер гипофарингеальных желез у медоносной пчелы ( Apis-Mellifera L ). J. Insect Physiol 35: 595-602. DOI: https: //doi.org/10.1016/0022-1910 (89)

      -2.
    60. 60. Фишер П., Грозингер С.М. (2008) Феромонная регуляция устойчивости к голоданию у рабочих медоносных пчел ( Apis mellifera ). Naturwissenschaften 95: 723-729.DOI: https: //doi.org/10.1007/s00114-008-0378-8. PubMed: 18414825.
    61. 61. Томпсон Г.Дж., Йоки Х., Лим Дж., Олдройд Б.П. (2007) Экспериментальные манипуляции с активацией яичников и экспрессией генов у маток и рабочих медоносных пчел ( Apis mellifera ): проверка гипотез регуляции репродуктивной функции. Журнал J Exp Zool Aecol Genet Physiology 307A: 600-610. DOI: https: //doi.org/10.1002/jez.415. PubMed: 17786975.
    62. 62. Alaux C, Brunet JL, Dussaubat C, Mondet F, Tchamitchan S et al.(2010) Взаимодействие между микроспорами Nosema и неоникотиноидом ослабляет медоносных пчел ( Apis mellifera ). Environ Microbiol 12: 774-782. DOI: https: //doi.org/10.1111/j.1462-2920.2009.02123.x. PubMed: 20050872.
    63. 63. Malone LA, Gatehouse HS (1998) Влияние инфекции Nosema apis на активность пищеварительного протеолитического фермента медоносной пчелы ( Apis mellifera ). J Invertebr Pathol 71: 169-174. DOI: https: //doi.org/10.1006/jipa.1997.4715.
    64. 64.Higes M, García-Palencia P, Martín-Hernández R, Meana A (2007) Экспериментальное заражение медоносных пчел Apis mellifera Nosema ceranae (Microsporidia). J Invertebr Pathol 94: 211-217. DOI: https: //doi.org/10.1016/j.jip.2006.11.001. PubMed: 17217954.
    65. 65. Forsgren E, Fries I (2010) Сравнительная вирулентность Nosema ceranae и Nosema apis у отдельных европейских медоносных пчел. Vet Parasitol 170: 212-217. doi: https: // doi.org / 10.1016 / j.vetpar.2010.02.010. PubMed: 20299152.
    66. 66. Боуниас М., Крук И., Некту М., Попескович Д. (1996) Токсикология солей меди на медоносных пчелах. V. Действие глюконата и сульфата на щелочные и кислые фосфатазы кишечника. Ecotoxicol Environ Saf 35: 67-76. DOI: https://doi.org/10.1006/eesa.1996.0082. PubMed: 8930506.
    67. 67. Веб-сайт Comprehensive R Archive Network. Доступный: . http://www.R-project.org/. По состоянию на 28 мая 2013 г.
    68. 68. Cox DR (1972) Модели регрессии и таблицы дожития.Биометрия 38: 67–77.
    69. 69. de Groot AP (1953) Потребность медоносной пчелы в белках и аминокислотах ( Apis mellifica L.). Physiol Comp Oecol 3:. С. 197-285.
    70. 70. Bitondi MMG, Simões ZLP (1996) Взаимосвязь между уровнем пыльцы в рационе, вителлогенином и титрами ювенильных гормонов у африканизированных рабочих Apis mellifera . J Apic Res 35: 27-36.
    71. 71. Хан Д.А., Денлингер Д.Л. (2011) Энергетика диапаузы насекомых.Анну Преподобный Энтомол 56: 103-121. DOI: https: //doi.org/10.1146/annurev-ento-112408-085436. PubMed: 206.
    72. 72. Toth AL, Kantarovich S, Meisel AF, Robinson GE (2005) Статус питания влияет на социально регулируемый онтогенез кормодобывания медоносных пчел. J Exp Biol 208: 4641-4649. DOI: https: //doi.org/10.1242/jeb.01956. PubMed: 16326945.
    73. 73. Герберт Э. У., Шимануки Х., Шаша Б. С. (1980) Выращивание выводка и потребление пищи пчелиными колониями, питаемыми заменителями пыльцы с добавлением экстрактов пыльцы, инкапсулированных в крахмал.J Apicult Res 19: 115-118.
    74. 74. Tasei JN, Aupinel P (2008) Питательная ценность 15 отдельных пыльцы и смесей пыльцы, протестированных на личинках, произведенных рабочими шмелей ( Bombus terrestris , Hymenoptera: Apidae). Apidologie 39: 397-409. DOI: https: //doi.org/10.1051/apido: 2008017.
    75. 75. Ли К.П., Симпсон С.Дж., Уилсон К. (2008) Качество диетического белка влияет на меланизацию и иммунную функцию у насекомых. Funct Ecol 22: 1052-1061. doi: https: //doi.org/10.1111 / j.1365-2435.2008.01459.x.
    76. 76. Клемола Н., Клемола Т., Рантала М.Дж., Руухола Т. (2007) Естественное качество растения-хозяина влияет на иммунную защиту насекомых-травоядных. Entomol Exp Appl 123: 167-176. DOI: https: //doi.org/10.1111/j.1570-7458.2007.00533.x.
    77. 77. Lee KP, Cory JS, Wilson K, Raubenheimer D, Simpson SJ (2006) Гибкий выбор диеты компенсирует белковые затраты на устойчивость к патогенам у гусеницы. Proc Biol Sci 273: 823-829. DOI: https: //doi.org/10.1098/rspb.2005.3385. PubMed: 16618675.
    78. 78. Брейкфилд П.М. (1987) Промышленный меланизм: есть ли у нас ответы? Trends Ecol Evol 2: 117-122. DOI: https: //doi.org/10.1016/0169-5347 (87)

      -6. PubMed: 21227832.
    79. 79. Campana BJ, Moeller FE (1977) Медоносные пчелы: предпочтение и пищевая ценность пыльцы из 5 растительных источников. J Econ Entomol 70: 39-41.
    80. 80. Сингх Р.П., Сингх П.Н. (1996) Спектры аминокислот и липидов личинок медоносной пчелы ( Apis cerana Fabr), питающихся пыльцой горчицы.Апидология 27: 21-28. DOI: https: //doi.org/10.1051/apido: 19960103.
    81. 81. Foley K, Fazio G, Jensen AB, Hughes WOH (2012) Ограничение питания и устойчивость к условно-патогенным паразитам Aspergillus у личинок медоносных пчел. Дж. Инвертебр Патол 111: 68-73. DOI: https://doi.org/10.1016/j.jip.2012.06.006. PubMed: 22750047.
    82. 82. Eguchi M (1995) Изоферменты щелочной фосфатазы у насекомых и сравнение с ферментом млекопитающих. Comp Biochem Physiol B Biochem Mol Biol 111: 151-162.DOI: https: //doi.org/10.1016/0305-0491 (94) 00248-S. PubMed: 7599983.
    83. 83. Le Conte Y, Navajas M (2008) Изменение климата: влияние на популяции медоносных пчел и их болезни. Rev Sci Tech Off Int Epiz 27: 499-510. PubMed: 18819674.

    Пищевая ценность собранной пчелами пыльцы выносливого киви, Actinidia arguta (Actinidiaceae) и дуба, Quercus sp. (Fagaceae)

    https://doi.org/10.1016/j.aspen.2017.01.009Получить права и контент

    Основные моменты

    Из пыльцы было получено высокое содержание белка (24–26%).

    Незаменимые компоненты пыльцы дуба и киви, отвечающие минимальным требованиям, предъявляемым к человеку.

    Пыльца обладает превосходными источниками незаменимых и полезных жирных кислот, на которые указывают AI или TI.

    Самым распространенным минералом в обеих пыльцах был калий, за которым следовал фосфор.

    Abstract

    Пыльца, собранная пчелами, привлекла внимание как естественная пищевая добавка к питанию человека по сравнению с кормом для пчел и стала важным коммерческим продуктом для ульев для пчеловодов.Дубы, Quercus sp. (Семейство: Fagaceae) и выносливые киви, Actinidia arguta (Семейство: Actinidiaceae) являются важными источниками пыльцы для медоносных пчел. Во время сбора и хранения за счет добавления нектара и слюнных выделений химический состав пыльцы изменяется. Мы проанализировали содержание питательных веществ в собранной пчелой пыльце дуба и выносливой пыльце киви и сравнили с рекомендуемой потребностью в незаменимых аминокислотах для развития расплода медоносных пчел. Результаты показали, что содержание белка было обнаружено 23.2% для дуба и 26,5% для выносливой пыльцы киви. Все определенное содержание незаменимых аминокислот как в пыльце дуба, так и в пыльце киви удовлетворяет минимальные индивидуальные потребности в аминокислотах медоносной пчелы. В морозостойкой пыльце киви треонин присутствовал в предельных количествах. Жирность пыльцы дуба и морозостойкой пыльцы киви составила 7 и 4,5% соответственно. Более высокое значение полиненасыщенной жирной кислоты / насыщенной жирной кислоты — стеариновой кислоты, более низкие значения AI и TI, наличие незаменимой жирной кислоты n-3 линоленовой кислоты указали на эти пыльцы как на превосходные источники жира.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *